ID: 941470891

View in Genome Browser
Species Human (GRCh38)
Location 2:165885520-165885542
Sequence AGAGGGTGAGGCTCAGTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470891_941470905 13 Left 941470891 2:165885520-165885542 CCAATTACTGAGCCTCACCCTCT No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data
941470891_941470900 3 Left 941470891 2:165885520-165885542 CCAATTACTGAGCCTCACCCTCT No data
Right 941470900 2:165885546-165885568 CACCTCAGCCCACCTCAGGTGGG No data
941470891_941470895 -1 Left 941470891 2:165885520-165885542 CCAATTACTGAGCCTCACCCTCT No data
Right 941470895 2:165885542-165885564 TCCCCACCTCAGCCCACCTCAGG No data
941470891_941470899 2 Left 941470891 2:165885520-165885542 CCAATTACTGAGCCTCACCCTCT No data
Right 941470899 2:165885545-165885567 CCACCTCAGCCCACCTCAGGTGG No data
941470891_941470908 27 Left 941470891 2:165885520-165885542 CCAATTACTGAGCCTCACCCTCT No data
Right 941470908 2:165885570-165885592 CAGGAGAGGAGAGAAGATAGAGG No data
941470891_941470902 8 Left 941470891 2:165885520-165885542 CCAATTACTGAGCCTCACCCTCT No data
Right 941470902 2:165885551-165885573 CAGCCCACCTCAGGTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470891 Original CRISPR AGAGGGTGAGGCTCAGTAAT TGG (reversed) Intronic
No off target data available for this crispr