ID: 941470892

View in Genome Browser
Species Human (GRCh38)
Location 2:165885532-165885554
Sequence GCTGAGGTGGGGAGAGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470892_941470899 -10 Left 941470892 2:165885532-165885554 CCTCACCCTCTCCCCACCTCAGC No data
Right 941470899 2:165885545-165885567 CCACCTCAGCCCACCTCAGGTGG No data
941470892_941470905 1 Left 941470892 2:165885532-165885554 CCTCACCCTCTCCCCACCTCAGC No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data
941470892_941470902 -4 Left 941470892 2:165885532-165885554 CCTCACCCTCTCCCCACCTCAGC No data
Right 941470902 2:165885551-165885573 CAGCCCACCTCAGGTGGGCCAGG No data
941470892_941470900 -9 Left 941470892 2:165885532-165885554 CCTCACCCTCTCCCCACCTCAGC No data
Right 941470900 2:165885546-165885568 CACCTCAGCCCACCTCAGGTGGG No data
941470892_941470908 15 Left 941470892 2:165885532-165885554 CCTCACCCTCTCCCCACCTCAGC No data
Right 941470908 2:165885570-165885592 CAGGAGAGGAGAGAAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470892 Original CRISPR GCTGAGGTGGGGAGAGGGTG AGG (reversed) Intronic
No off target data available for this crispr