ID: 941470893

View in Genome Browser
Species Human (GRCh38)
Location 2:165885537-165885559
Sequence GGTGGGCTGAGGTGGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470893_941470908 10 Left 941470893 2:165885537-165885559 CCCTCTCCCCACCTCAGCCCACC No data
Right 941470908 2:165885570-165885592 CAGGAGAGGAGAGAAGATAGAGG No data
941470893_941470905 -4 Left 941470893 2:165885537-165885559 CCCTCTCCCCACCTCAGCCCACC No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data
941470893_941470902 -9 Left 941470893 2:165885537-165885559 CCCTCTCCCCACCTCAGCCCACC No data
Right 941470902 2:165885551-165885573 CAGCCCACCTCAGGTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470893 Original CRISPR GGTGGGCTGAGGTGGGGAGA GGG (reversed) Intronic
No off target data available for this crispr