ID: 941470894

View in Genome Browser
Species Human (GRCh38)
Location 2:165885538-165885560
Sequence AGGTGGGCTGAGGTGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470894_941470908 9 Left 941470894 2:165885538-165885560 CCTCTCCCCACCTCAGCCCACCT No data
Right 941470908 2:165885570-165885592 CAGGAGAGGAGAGAAGATAGAGG No data
941470894_941470902 -10 Left 941470894 2:165885538-165885560 CCTCTCCCCACCTCAGCCCACCT No data
Right 941470902 2:165885551-165885573 CAGCCCACCTCAGGTGGGCCAGG No data
941470894_941470905 -5 Left 941470894 2:165885538-165885560 CCTCTCCCCACCTCAGCCCACCT No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470894 Original CRISPR AGGTGGGCTGAGGTGGGGAG AGG (reversed) Intronic
No off target data available for this crispr