ID: 941470896

View in Genome Browser
Species Human (GRCh38)
Location 2:165885543-165885565
Sequence ACCTGAGGTGGGCTGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470896_941470910 28 Left 941470896 2:165885543-165885565 CCCCACCTCAGCCCACCTCAGGT No data
Right 941470910 2:165885594-165885616 CTGCTATGTATTTGTCAGCCAGG No data
941470896_941470905 -10 Left 941470896 2:165885543-165885565 CCCCACCTCAGCCCACCTCAGGT No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data
941470896_941470908 4 Left 941470896 2:165885543-165885565 CCCCACCTCAGCCCACCTCAGGT No data
Right 941470908 2:165885570-165885592 CAGGAGAGGAGAGAAGATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470896 Original CRISPR ACCTGAGGTGGGCTGAGGTG GGG (reversed) Intronic
No off target data available for this crispr