ID: 941470905

View in Genome Browser
Species Human (GRCh38)
Location 2:165885556-165885578
Sequence CACCTCAGGTGGGCCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941470892_941470905 1 Left 941470892 2:165885532-165885554 CCTCACCCTCTCCCCACCTCAGC No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data
941470894_941470905 -5 Left 941470894 2:165885538-165885560 CCTCTCCCCACCTCAGCCCACCT No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data
941470891_941470905 13 Left 941470891 2:165885520-165885542 CCAATTACTGAGCCTCACCCTCT No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data
941470893_941470905 -4 Left 941470893 2:165885537-165885559 CCCTCTCCCCACCTCAGCCCACC No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data
941470896_941470905 -10 Left 941470896 2:165885543-165885565 CCCCACCTCAGCCCACCTCAGGT No data
Right 941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941470905 Original CRISPR CACCTCAGGTGGGCCAGGAG AGG Intronic
No off target data available for this crispr