ID: 941472627

View in Genome Browser
Species Human (GRCh38)
Location 2:165907776-165907798
Sequence GTTCATTTACTATGAAAGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 1, 2: 7, 3: 33, 4: 302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941472626_941472627 -8 Left 941472626 2:165907761-165907783 CCATGAGAGCTGACAGTTCATTT 0: 1
1: 0
2: 2
3: 34
4: 226
Right 941472627 2:165907776-165907798 GTTCATTTACTATGAAAGAATGG 0: 1
1: 1
2: 7
3: 33
4: 302
941472624_941472627 -1 Left 941472624 2:165907754-165907776 CCATCCTCCATGAGAGCTGACAG 0: 1
1: 0
2: 1
3: 22
4: 312
Right 941472627 2:165907776-165907798 GTTCATTTACTATGAAAGAATGG 0: 1
1: 1
2: 7
3: 33
4: 302
941472625_941472627 -5 Left 941472625 2:165907758-165907780 CCTCCATGAGAGCTGACAGTTCA 0: 1
1: 0
2: 2
3: 11
4: 140
Right 941472627 2:165907776-165907798 GTTCATTTACTATGAAAGAATGG 0: 1
1: 1
2: 7
3: 33
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941472627 Original CRISPR GTTCATTTACTATGAAAGAA TGG Exonic
901333857 1:8431701-8431723 GTTAATTTATTATTGAAGAAAGG - Intronic
902932106 1:19738778-19738800 ATTCAATTACTATGGAAAAAAGG - Intronic
903581459 1:24373917-24373939 GTTCATTTGCTAAGAAGGACAGG - Intronic
906972589 1:50532625-50532647 TTTCATTTACTCTGAAGGAAAGG - Intronic
907352027 1:53839898-53839920 GTTCAATTATTATGAAAGAAGGG - Intergenic
907879303 1:58530277-58530299 ATTCAGTTACTACGAAAGGAAGG + Intronic
908404172 1:63797639-63797661 GTTCATTTGCTTTCATAGAAGGG - Intronic
909800805 1:79805541-79805563 ATTCTTTTACTGTGAAAGAAAGG - Intergenic
912227120 1:107746586-107746608 GTTCTTTTACTATGGAAGAAGGG - Intronic
917624828 1:176835117-176835139 TTTAATTTACTGAGAAAGAAGGG - Intronic
918001423 1:180501167-180501189 TTTCCTTTACTGTAAAAGAAGGG + Intronic
919546765 1:198932099-198932121 GTTGAATTAAGATGAAAGAATGG - Intergenic
922122791 1:222689733-222689755 GTTAATTTATTATTAAAGACAGG + Intronic
1062816111 10:501571-501593 CTTCATTTAAAATGAAAAAAAGG + Intronic
1063013495 10:2049999-2050021 GTTAATATAATATGAAATAAAGG + Intergenic
1063244870 10:4207270-4207292 GTTCATTTATTATTAAACTAAGG + Intergenic
1063919525 10:10918484-10918506 ATTCATTTACTAAGGAAGTATGG + Intergenic
1065512695 10:26494898-26494920 GTTTAGATTCTATGAAAGAAGGG + Intronic
1065551425 10:26871791-26871813 GTTCATGTACCATCAAAGCAGGG - Intergenic
1067250795 10:44585264-44585286 GTTAATTTACTATTGAACAAAGG - Intergenic
1067956656 10:50798385-50798407 ATTCTTTTACTATGAAAGAACGG - Intronic
1069125727 10:64630030-64630052 GTTAATTTATTATTAAAAAAAGG + Intergenic
1070591467 10:77804905-77804927 GTTCAGTTACTGAGGAAGAATGG - Intronic
1070628264 10:78066602-78066624 GGTTACTTACAATGAAAGAAAGG + Intergenic
1070940737 10:80344215-80344237 GCTCATTTGTTATGAAAGCAAGG + Intronic
1071216319 10:83406663-83406685 GATCTTTTAGTATGGAAGAATGG - Intergenic
1071393567 10:85199524-85199546 GTTCATTTAATTTGGAAGAGAGG + Intergenic
1071560194 10:86640162-86640184 GGTCATTTAATATCAAAGGAAGG - Intergenic
1072133334 10:92518145-92518167 CTTCATTTAGTAGAAAAGAAAGG - Intronic
1072204883 10:93194933-93194955 GTTTTATTACTATGAAACAAAGG + Intergenic
1072289933 10:93954753-93954775 GTTAATTTATTATTGAAGAAAGG + Intronic
1072606423 10:96987200-96987222 GTTCATTTAATCTTAAAAAATGG + Intergenic
1072829921 10:98646926-98646948 GTTTATTTACTATGAAAAACTGG - Intronic
1074428819 10:113375375-113375397 GTTCTATTGCTATCAAAGAAGGG - Intergenic
1076064494 10:127438735-127438757 GTTCATTTACGATGGGAGGATGG - Intronic
1078501495 11:11883535-11883557 GTTAATTTCCTAAGAAATAAAGG + Intronic
1079069577 11:17332393-17332415 ATTCTTTTACTAAGGAAGAAGGG + Intronic
1080808231 11:35675980-35676002 GTTCTTTTACTAAGGAAAAATGG + Intronic
1080950126 11:37022254-37022276 GATCATTATCTGTGAAAGAAAGG + Intergenic
1081458637 11:43250364-43250386 TTTCTTTTGCTATGGAAGAAGGG - Intergenic
1081685497 11:45040087-45040109 ATTCATTTAGTAAGAAAGACTGG - Intergenic
1082630775 11:55539388-55539410 TTTTATTAACTGTGAAAGAATGG + Intergenic
1083514115 11:63240475-63240497 GTTAATTTATTATTGAAGAAAGG - Intronic
1085315317 11:75541295-75541317 GTGCTATTACTATGGAAGAAGGG - Intergenic
1086949910 11:92881307-92881329 GTTTCTTTCTTATGAAAGAAAGG - Intronic
1087862674 11:103180933-103180955 ATTAATTTGCTATGAAACAATGG + Intronic
1090652343 11:128818290-128818312 GTTAATTTATTATTGAAGAAAGG - Intergenic
1092487039 12:8911370-8911392 ATTCTTTTCCTATGAGAGAAGGG + Intergenic
1093008303 12:14076570-14076592 GTTAATTTATTATTAAAGAAAGG + Intergenic
1093632644 12:21427975-21427997 GTTCCTTTAGTAAGAAAGCAGGG + Intergenic
1093739921 12:22673400-22673422 TTTCATTTTTTATGAAAAAATGG + Intronic
1093863157 12:24192728-24192750 GTTCATTTAGAATGAAAAACTGG - Intergenic
1095647470 12:44564838-44564860 GTGCATTTGCTATGAAATGAGGG + Intronic
1095760928 12:45835323-45835345 GTTCAATAACCAAGAAAGAAGGG - Intronic
1096366955 12:51036149-51036171 GTTCAGTTCCTATAAAAGAAAGG - Intergenic
1098163153 12:67666884-67666906 GTTTAATTTCTATGAAAGGAAGG - Intergenic
1099546135 12:83982481-83982503 GTTCAGTGACTATGAGTGAAGGG - Intergenic
1099599018 12:84707953-84707975 CTACATTTTCCATGAAAGAACGG - Intergenic
1100196536 12:92252750-92252772 GTTTATATAAAATGAAAGAAAGG + Intergenic
1102418023 12:112781316-112781338 GTTCATTTACTTTGCTGGAAAGG + Intronic
1102801220 12:115736063-115736085 GTTAATTTATTATTTAAGAAAGG - Intergenic
1103252330 12:119510981-119511003 GTTCAATTACTAAGAAAGAAGGG + Intronic
1104496659 12:129246907-129246929 GTTCATTTACTGGAAATGAAGGG + Intronic
1105277160 13:18942931-18942953 ATTCATTTACTATGACATCAGGG + Intergenic
1107640904 13:42442233-42442255 TTTCATTAACAAGGAAAGAAGGG - Intergenic
1107846479 13:44519258-44519280 TTTCATTTACTATGAAAAAAAGG - Intronic
1109023071 13:57123361-57123383 ATTCACTTGCTATGAAAGCATGG - Intergenic
1109244254 13:59933894-59933916 GAAAATTTAGTATGAAAGAAAGG - Intronic
1109248026 13:59981637-59981659 TTTCATTTAATAAAAAAGAAGGG - Intronic
1109582693 13:64363411-64363433 GGTCATTTACTGGAAAAGAATGG + Intergenic
1109825157 13:67709476-67709498 GTTAATTTACTTTGAAAGTCAGG - Intergenic
1110850841 13:80242791-80242813 GTTAATTTATTATTGAAGAAAGG + Intergenic
1110951306 13:81495297-81495319 TTTCATTTACTAAGAAATAAGGG + Intergenic
1111467560 13:88636033-88636055 TTTCATGTACTATGAAACTAAGG - Intergenic
1111592212 13:90364043-90364065 GTTCCATTAATATCAAAGAAGGG - Intergenic
1111868716 13:93802974-93802996 TTTCATTAACTGTGAAACAAAGG + Intronic
1112248485 13:97756241-97756263 AATCATTTTCTCTGAAAGAAAGG + Intergenic
1112503956 13:99963183-99963205 GTTTATTTATTATGAAACAAAGG - Exonic
1113197471 13:107825414-107825436 GCTCATTCACTTTTAAAGAACGG + Intronic
1113691441 13:112313757-112313779 CTGCATTTACCCTGAAAGAATGG - Intergenic
1114857214 14:26462990-26463012 GTTCTTTGACTATTAAAGATAGG + Intronic
1116052021 14:39815296-39815318 TTTCATTAACTTTGCAAGAATGG + Intergenic
1116421795 14:44741801-44741823 GTTTATCTATTATGAAAGATTGG + Intergenic
1116791637 14:49345865-49345887 GTTCATTTACCATCAAAGTTAGG - Intergenic
1118121363 14:62847779-62847801 GTTCATTTGCAGTTAAAGAAAGG - Intronic
1119304416 14:73595961-73595983 TTTCCATCACTATGAAAGAATGG + Exonic
1119596029 14:75934810-75934832 GTCCATTAACAATGAGAGAATGG - Intronic
1120906723 14:89627178-89627200 ATTCATTTTCTGTGAAATAAGGG - Intergenic
1121133605 14:91473397-91473419 GATCACTTATTATGAGAGAACGG + Intronic
1122357938 14:101135236-101135258 GTTCAGTAACTGTGAAATAAAGG - Intergenic
1123223732 14:106880373-106880395 GTTAAATTACAATGAAAAAATGG + Intergenic
1124093353 15:26626400-26626422 TTTCATTTACCATGAGAGATGGG - Intronic
1125095662 15:35848197-35848219 TTTAACTTACTATGAAATAATGG - Intergenic
1125161067 15:36644381-36644403 GTTCAATTACAAAGAAATAAAGG - Intronic
1125190647 15:36988707-36988729 GTTATCTTCCTATGAAAGAATGG - Intronic
1126680716 15:51199414-51199436 GTTTCTTTAGGATGAAAGAACGG - Intergenic
1127024317 15:54786019-54786041 GTGTTTTTACCATGAAAGAATGG + Intergenic
1127302826 15:57673771-57673793 GCTCATTTGTTTTGAAAGAAAGG - Intronic
1127373554 15:58362035-58362057 AGTCAATTACTATAAAAGAATGG + Intronic
1128906101 15:71468999-71469021 GTTCTCTTACTGTGGAAGAAAGG + Intronic
1129935205 15:79441927-79441949 GTTAATTTACAAAGAAAGGAAGG - Intronic
1132678415 16:1130156-1130178 GCTCATTTAATATGAACAAATGG + Intergenic
1134683510 16:16142953-16142975 GTTTATCTAATGTGAAAGAATGG - Exonic
1135002935 16:18791801-18791823 GCTTATTTACAATGAAAGTAAGG + Exonic
1136563059 16:31052510-31052532 GTTCAGTTACTCTGGGAGAAGGG + Intergenic
1136929338 16:34405154-34405176 TTTCAGTTACTGTGAAAGACCGG + Intergenic
1136975236 16:35006651-35006673 TTTCAGTTACTGTGAAAGACCGG - Intergenic
1137903221 16:52291602-52291624 GATCATTTTCTATGGAGGAAGGG + Intergenic
1138840445 16:60496135-60496157 GTTCACTTGCTATGGAAGCAAGG + Intergenic
1139013628 16:62663718-62663740 GTTCATTTATTTTGATAAAATGG - Intergenic
1142777458 17:2152253-2152275 GTTTATTTAAAATGAAAGAGGGG - Intronic
1144625624 17:16843051-16843073 GTTCATCTCCTATGGAAAAAGGG + Intergenic
1144880808 17:18429669-18429691 GTTCATCTCCTATGGAAAAAGGG - Intergenic
1145151428 17:20514718-20514740 GTTCATCTCCTATGGAAAAAGGG + Intergenic
1145820875 17:27834096-27834118 GTTAATTTATTATTGAAGAAAGG - Intronic
1146575983 17:33991900-33991922 GTTCATTTGCTTTGAACAAAAGG - Intronic
1147579779 17:41621746-41621768 GTTCATCTCCTATGGAAAAAGGG + Exonic
1148629963 17:49099812-49099834 ATTCTGTTACTAAGAAAGAAGGG - Intergenic
1149115598 17:53091700-53091722 GCTCATGTACTAGGAAGGAAAGG - Intergenic
1150173979 17:63030756-63030778 GTTCTTTTAGCATGAAATAAAGG + Intronic
1150177988 17:63082541-63082563 GTTGATTTATTAAGAAGGAAGGG + Intronic
1150961727 17:69920957-69920979 GAACATTTTGTATGAAAGAATGG + Intergenic
1151035608 17:70795308-70795330 GTTCAGTTGGTATGGAAGAATGG - Intergenic
1151091169 17:71441557-71441579 GTTCTATTACTTAGAAAGAATGG - Intergenic
1153439992 18:5105799-5105821 TTTAATTTTCTTTGAAAGAAAGG + Intergenic
1153510453 18:5846357-5846379 GAACATTTTGTATGAAAGAATGG + Intergenic
1153751025 18:8230933-8230955 GTTTATTTTTTATTAAAGAAGGG - Intronic
1155721767 18:29022528-29022550 GTTCATTTAGTCTGAATTAAAGG - Intergenic
1159319216 18:66824871-66824893 CTTCAATTACAATGTAAGAAGGG + Intergenic
1159390117 18:67781554-67781576 GTTCTTAAAATATGAAAGAAAGG + Intergenic
1159493903 18:69175665-69175687 GTTCTTTTATTCTGAAGGAAAGG + Intergenic
1160134372 18:76260050-76260072 GCTCTTTCACTTTGAAAGAAGGG + Exonic
1163805020 19:19390828-19390850 GATCTATTACAATGAAAGAATGG - Intronic
1167710876 19:51109713-51109735 GCTCATTTAATATGAAAGGAAGG - Intergenic
925521899 2:4755773-4755795 TTTCACTTAGTAGGAAAGAAAGG - Intergenic
925749985 2:7079411-7079433 TTTCATTCAATATAAAAGAAAGG + Intergenic
925959302 2:9000814-9000836 GTTAATTTATTATTGAAGAAAGG - Intronic
926399242 2:12479074-12479096 GTTACTGTACTCTGAAAGAAGGG + Intergenic
926612514 2:14960820-14960842 GTTCATTGACTATGAAACAATGG - Intergenic
929835854 2:45398155-45398177 GTTAATTTACTGTAAAAAAACGG - Intronic
930646077 2:53909369-53909391 CTTAATTTACTATGATAGGAAGG + Intronic
931201658 2:60103449-60103471 GTGCATTTCCTCTGAGAGAAAGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
933012370 2:77083737-77083759 GTTTTGTTACTATGAAAGAAAGG - Intronic
933095488 2:78173493-78173515 TTACAGTCACTATGAAAGAATGG - Intergenic
933939859 2:87236138-87236160 GTTCCTGGACTATGAAAGGAAGG - Intergenic
935767329 2:106381813-106381835 GTTCATTTTCTCCAAAAGAAAGG + Intergenic
935962597 2:108442177-108442199 GTTCACTGACTATTAAAAAATGG - Intergenic
936174630 2:110209091-110209113 GTTGATCTACTAGGAATGAAAGG + Intergenic
936353278 2:111729635-111729657 GTTCCTGGACTATGAAAGGAAGG + Intergenic
936735235 2:115433201-115433223 TTTCATGGGCTATGAAAGAAGGG + Intronic
936958978 2:118053560-118053582 GTTGATTAACTATGACAGATTGG + Intergenic
939679446 2:145112172-145112194 CGTCATTTCCTAGGAAAGAATGG + Intergenic
940500568 2:154488541-154488563 GTGCATTTAATATAAAAGATAGG + Intergenic
940701955 2:157056490-157056512 GTTCATCTACTATAAAAAAAGGG + Intergenic
940781122 2:157934650-157934672 GTTCTGTTAGTAAGAAAGAAAGG - Intronic
940828621 2:158442502-158442524 TTTCATTTAATTTGAAAGAATGG - Intronic
941472627 2:165907776-165907798 GTTCATTTACTATGAAAGAATGG + Exonic
942401906 2:175611620-175611642 GCTCATTTACAATGGTAGAATGG - Intergenic
942765223 2:179447554-179447576 GTTCATTTGCTATTCAAGACAGG + Intronic
943403333 2:187445933-187445955 GTTCATTCACTTTGAAAAATTGG - Intronic
945493268 2:210480363-210480385 GTTCAGCTACAATGAAAGAAGGG + Intronic
945668087 2:212766982-212767004 GTTTATTTACAATGAAAGCTTGG - Intergenic
945992809 2:216410699-216410721 GTTAATTTACTAAGAAAGCTGGG - Intergenic
946187881 2:217991337-217991359 TTTCATTTATTATGAAGGCATGG + Intronic
1169327954 20:4691612-4691634 GATCATTTACTATGATACAGTGG - Intronic
1170983776 20:21239670-21239692 GTTCATTTTATATGAACAAAAGG - Intronic
1173347949 20:42218072-42218094 GATCATTTGCTATTAAAGAAAGG - Intronic
1174058253 20:47814581-47814603 GTTCTATTACTAAGGAAGAAGGG - Intergenic
1174211316 20:48880742-48880764 GCTTATTTACTAGGAAAGAAGGG + Intergenic
1174214067 20:48902784-48902806 GTTCTTTTACTGTGAAGTAATGG - Intergenic
1174670440 20:52302685-52302707 GTCCAATTACTAAGAAAGAAGGG - Intergenic
1174856634 20:54051623-54051645 GATCATTTGCTATGTTAGAAGGG - Intronic
1175316275 20:58049333-58049355 ATTCATTTACCATGAATAAAAGG + Intergenic
1176890457 21:14311801-14311823 GTTCTTTTTCTAGAAAAGAAGGG + Intergenic
1177324236 21:19563177-19563199 GTTCAATTACTCTAAAAAAATGG - Intergenic
1177664365 21:24134544-24134566 GTTAATTTATTATTAAAGAAAGG - Intergenic
1178176216 21:30102571-30102593 TTACATGTATTATGAAAGAATGG - Intergenic
1179615440 21:42580333-42580355 GTTCCTTAAATCTGAAAGAAAGG - Exonic
1179708524 21:43196081-43196103 GTTCATTTCCTTTTAAACAAAGG + Intergenic
1180929655 22:19580222-19580244 ATTCATTTACTATCAAAGTTGGG + Intergenic
1182247005 22:28966787-28966809 GTTAATTTATTATTGAAGAAAGG + Intronic
1182965090 22:34513932-34513954 ATTCTATTACTCTGAAAGAAGGG - Intergenic
1183288179 22:36981056-36981078 GTTAATTTTCTAAGAAAGAGAGG - Intergenic
952218740 3:31303433-31303455 ATTCTTTTAGTAAGAAAGAAGGG - Intergenic
953149044 3:40307700-40307722 GTACATCTACTAAGAAAGAAAGG + Intergenic
953708823 3:45252354-45252376 GTTCTTTCAGTATAAAAGAAAGG + Intergenic
955449989 3:59056143-59056165 AATAATTTAATATGAAAGAAAGG + Intergenic
956294820 3:67700920-67700942 GTTCATTTAAGATGGAGGAAAGG - Intergenic
956649373 3:71489750-71489772 GTTAATTTATTATGCAAGCATGG + Intronic
957829647 3:85500284-85500306 GTTTATTTTCTATAAAAAAATGG + Intronic
957950475 3:87119809-87119831 GCTCATTTACTAGGATTGAAGGG + Intergenic
958070635 3:88606353-88606375 ATTCATTTTTTAAGAAAGAAAGG + Intergenic
959538449 3:107513348-107513370 GTCCCTTTACAATGGAAGAATGG - Intergenic
960361863 3:116722398-116722420 GTGCTATTACTAAGAAAGAAGGG + Intronic
960820991 3:121731316-121731338 GTGAAACTACTATGAAAGAAGGG - Intronic
960889679 3:122434404-122434426 GTTCACATGCTATGAGAGAATGG - Intronic
963627803 3:147694997-147695019 GATCATTTCCTCTGAAAAAAAGG - Intergenic
965364964 3:167786719-167786741 GTTAATTTATTATTGAAGAAAGG - Intronic
965923030 3:173942707-173942729 TGTCATTAACTATGAAAAAAGGG - Intronic
966560881 3:181319063-181319085 GTACATTTACTATGAAAATATGG - Intergenic
967227057 3:187302142-187302164 CTTCAGTCACTATGTAAGAAAGG + Intergenic
967620003 3:191621265-191621287 AATCATTTATTATTAAAGAAAGG - Intergenic
970426539 4:15950986-15951008 GATCATTTACATTGAAAGAAGGG - Intergenic
970791388 4:19861836-19861858 CTTCTTTCACTATGGAAGAAGGG + Intergenic
972174419 4:36386013-36386035 GTTCCTGTACTCTGAAGGAAGGG + Intergenic
973687390 4:53386076-53386098 GTTCATTTTATATGTAAGTAAGG + Intronic
973961066 4:56110413-56110435 GTGCATTTACCATGAAAGTGAGG + Intergenic
976485894 4:85604382-85604404 GTTTACTTACTATTAAATAAAGG - Intronic
976783807 4:88792858-88792880 GTTCATTTTCCATGAAGGGAGGG + Intronic
977056177 4:92194456-92194478 GATAATTTACTATGTAATAAAGG + Intergenic
978050305 4:104190647-104190669 GTTCTTTTAGTAATAAAGAAGGG - Intergenic
978085576 4:104648686-104648708 GATCATTTACTATGATGGAGTGG + Intergenic
978182680 4:105819069-105819091 GTACATTAAATATGAAAGCAAGG + Intronic
978503992 4:109436969-109436991 GTTCAATTACTTTGGTAGAAGGG - Intronic
979723079 4:123926115-123926137 GATCAATTACTGTGAAAGGAAGG + Intergenic
979794305 4:124827405-124827427 GTCAATTTAATATTAAAGAAAGG + Intergenic
980211406 4:129792736-129792758 GATCATTTACTACTAAATAAAGG - Intergenic
980517867 4:133888340-133888362 GTCCTTTTACTGGGAAAGAAAGG + Intergenic
980574921 4:134673607-134673629 CTTCTTTTACTATTGAAGAAAGG - Intergenic
980698595 4:136394190-136394212 GTTACTTTGCTAAGAAAGAAAGG - Intergenic
980958318 4:139450689-139450711 CTTGATTGCCTATGAAAGAAAGG - Intergenic
981543000 4:145865258-145865280 TTTAATTTATTATGAAATAATGG - Intronic
981701243 4:147609459-147609481 ACTCTTTTACTATGACAGAAAGG + Intergenic
981799878 4:148643118-148643140 ATTCATTTACTAAGAAAAACAGG - Intergenic
981842109 4:149124519-149124541 GTTTTCTTTCTATGAAAGAAGGG + Intergenic
982248861 4:153383865-153383887 GTCCTGTTACTAAGAAAGAATGG + Intronic
982533777 4:156582143-156582165 ATTATTTTACTATGAAGGAAAGG - Intergenic
982924506 4:161319173-161319195 GTTAATTTATTATTGAAGAAAGG + Intergenic
983010694 4:162542520-162542542 TTTTAATTACAATGAAAGAATGG - Intergenic
983546256 4:168967522-168967544 GTTCTATTATTATGAAGGAAAGG + Intronic
984226745 4:177044412-177044434 GTTCTTTTAGTGAGAAAGAAAGG - Intergenic
986432661 5:7696912-7696934 GTTCATTTATAAGAAAAGAAAGG + Intronic
988981568 5:36574850-36574872 GTACATTCACTATGAGAGAAAGG - Intergenic
992500998 5:77343690-77343712 GCTAATTTACTATTGAAGAAAGG - Intronic
994059031 5:95453502-95453524 GTGAATTTACTGTGAAACAATGG - Intergenic
994980325 5:106866582-106866604 GTTTTTTTTCTTTGAAAGAAAGG - Intergenic
995385974 5:111589230-111589252 CTTAATCTACTATGAAAGATTGG - Intergenic
995498271 5:112772835-112772857 GTTCATTTATTAGGAAGTAATGG + Intronic
995664512 5:114526439-114526461 GATCATGTCCTATGCAAGAATGG + Intergenic
995802550 5:116013999-116014021 GTTCTTTCTCTATAAAAGAAAGG - Intronic
996201089 5:120674354-120674376 GTTAATTAACTTTTAAAGAATGG + Intronic
996341112 5:122439977-122439999 CTTCCTTTAACATGAAAGAAGGG + Intronic
1003358459 6:5398567-5398589 GTTCCTTTTTTATTAAAGAATGG + Intronic
1004898254 6:20169939-20169961 GTTCATTGGCTTTGCAAGAAAGG - Intronic
1008718155 6:54314886-54314908 CTCCATTCACTATGAAAGGAAGG + Intronic
1009600833 6:65796088-65796110 GTTCATTTAACAAAAAAGAATGG + Intergenic
1010158537 6:72823934-72823956 ATGTGTTTACTATGAAAGAAGGG - Intronic
1010380289 6:75216080-75216102 GTTCTGTTACTATGCAAGAAGGG + Intergenic
1011030908 6:82921517-82921539 GTTCATTTACTATGGGCGAGTGG - Intronic
1011094468 6:83644479-83644501 TTACCTTTACTGTGAAAGAAAGG - Intronic
1011834278 6:91411193-91411215 GTTCATATACCATGACAAAATGG - Intergenic
1012297249 6:97540452-97540474 TTTCATATATTATGAAAGAGTGG + Intergenic
1012646321 6:101686874-101686896 TTGCATAAACTATGAAAGAAGGG + Intronic
1013671850 6:112412270-112412292 ATTCTTTTAATAAGAAAGAATGG - Intergenic
1014106266 6:117566060-117566082 CTTCTTTTACTATGAATGGATGG + Intronic
1014158658 6:118141012-118141034 GTTAATTTACTATTAAAGAAAGG + Intronic
1014181343 6:118387773-118387795 ATCCTATTACTATGAAAGAAAGG - Intergenic
1014214761 6:118742356-118742378 GGTGATTTAAGATGAAAGAAAGG - Intergenic
1014694882 6:124608155-124608177 GTTCATTTGGTATGAAAACATGG - Intronic
1015781203 6:136867856-136867878 GTTAATTTATTATTGAAGAAAGG + Intronic
1015807910 6:137131182-137131204 GTTCATTTAAAATCAAAGTACGG + Intergenic
1016093556 6:140008485-140008507 GTCCAGTTGCTATGTAAGAAAGG - Intergenic
1016660557 6:146574017-146574039 GATCATTTACTATGATCAAATGG + Intergenic
1016823077 6:148363995-148364017 ATGCATTTACTCTGAATGAATGG - Intronic
1016935809 6:149448786-149448808 TGTCATTTACCATGAATGAAAGG + Intronic
1019864411 7:3693014-3693036 GTTCATTTATTTTGTAAAAAAGG - Intronic
1021336339 7:19407328-19407350 GTACATTTCCTATCAAAGTAAGG - Intergenic
1021380908 7:19965073-19965095 GTTTATTAACTAAGAAATAATGG + Intergenic
1021405110 7:20257480-20257502 GTTCAATTTCTATGAAAGACTGG - Intergenic
1022021644 7:26405255-26405277 GTTCCTTTACTATGGTAGTAAGG + Intergenic
1022571140 7:31455503-31455525 TTGCATTTACTATAATAGAAGGG + Intergenic
1024124882 7:46283614-46283636 GTTCTTTTATTATGAAAATATGG + Intergenic
1024438753 7:49390004-49390026 GTTCATTTACTAAGCATGAGAGG - Intergenic
1027602388 7:80255065-80255087 GTACATTTCCTATGAAATAGGGG + Intergenic
1028319762 7:89445037-89445059 GTTCAAACATTATGAAAGAATGG - Intergenic
1028619976 7:92814662-92814684 TTTCTTTTACTGAGAAAGAATGG - Intronic
1028658940 7:93244932-93244954 TATGATTTGCTATGAAAGAAGGG - Intronic
1028878826 7:95855973-95855995 GTTAATTTACTATTGAAGAAAGG - Intronic
1029299845 7:99572112-99572134 GTTTATTTACTCTGAAAAACAGG - Intronic
1029559684 7:101294385-101294407 GTTCTTGTAAAATGAAAGAAAGG - Intergenic
1029862880 7:103593571-103593593 TTTCATATTCTATTAAAGAAGGG - Intronic
1030479346 7:110082843-110082865 GGGCATTTATTAGGAAAGAATGG + Intergenic
1030636994 7:111961420-111961442 ATTCACTCACTATGAAAGCATGG - Intronic
1030827728 7:114181454-114181476 GTTCATTTACCATATAAGGAAGG - Intronic
1031412102 7:121451844-121451866 GTTCATCTACTGTAAAGGAAGGG - Intergenic
1031575654 7:123412914-123412936 GGTCCTAAACTATGAAAGAAGGG - Intergenic
1032101365 7:128981103-128981125 TTTCATTTACTGTGAAATAAGGG + Intronic
1033186841 7:139234362-139234384 GTTCATTTAGTATTTAAGAAGGG - Intronic
1034391464 7:150790851-150790873 TATCATTTACAATGAAAGGAAGG + Intergenic
1035904581 8:3495699-3495721 GTTCTTTTACTCTGAAAGGATGG - Intronic
1036183688 8:6606457-6606479 GTTCATGTTCTATTAAAGCAAGG + Intronic
1036438203 8:8755692-8755714 TTTTTTTTACTATCAAAGAATGG - Intergenic
1041187214 8:55313673-55313695 GTTCACTTTCTGTAAAAGAATGG - Intronic
1041415557 8:57604070-57604092 GTACATGTACTAGGAAAGAATGG + Intergenic
1041538915 8:58961070-58961092 CTTCATATACTATGAAAAAATGG + Intronic
1041971880 8:63752706-63752728 GATCAGTTATTATGCAAGAAGGG + Intergenic
1042003299 8:64151445-64151467 TTTAATTTACTCTGAAATAATGG + Intergenic
1043262739 8:78222245-78222267 GATCATTAAATATGAAAGAAGGG + Intergenic
1043549115 8:81348996-81349018 ATTCAATTACTCTGAAATAAAGG + Intergenic
1043909363 8:85842858-85842880 CTTCATTTGCGGTGAAAGAAAGG - Intergenic
1043909534 8:85845466-85845488 GTTAATTTATTATTGAAGAAAGG + Intergenic
1044372649 8:91430747-91430769 CTTCATTTACCATGAAAGGCTGG + Intergenic
1044734007 8:95259090-95259112 GTTAATTTTTTAAGAAAGAATGG - Intronic
1045872552 8:106942767-106942789 GCTGACTTACTATGTAAGAAAGG - Intergenic
1046086379 8:109441389-109441411 ATTTATATACTATGAAATAATGG + Intronic
1046589819 8:116192763-116192785 GTTCACTTACTTTTAGAGAAAGG + Intergenic
1046824495 8:118672455-118672477 GATCATTCACTAGGATAGAATGG + Intergenic
1047971575 8:130089053-130089075 GTTCATGTACTAGGAAAGACAGG + Intronic
1048502205 8:134988517-134988539 TCTCATTTACAATGAAATAATGG - Intergenic
1051322823 9:15927713-15927735 GTTCAGTTAAGATGAAAAAAAGG + Intronic
1051672439 9:19524782-19524804 GTTCCTTTTCTTTGAAAGAATGG + Intronic
1051773613 9:20608990-20609012 GTTCATTTTCTGTGTTAGAATGG - Intronic
1052180552 9:25521286-25521308 TTTCATTCACAAAGAAAGAATGG - Intergenic
1054864972 9:69990449-69990471 CTTCATTCACTATAAAAAAATGG - Intergenic
1055319312 9:75066681-75066703 ATTCATTACATATGAAAGAATGG - Intronic
1056070025 9:82976574-82976596 TTTCATTTAATATGAAAGGCTGG + Intergenic
1056296087 9:85194381-85194403 GGTCTTTGACTATGAAACAAGGG + Intergenic
1057509161 9:95663423-95663445 GTACCTTTGCTATAAAAGAAAGG + Intergenic
1057539564 9:95953645-95953667 ATTCATTTATTAAAAAAGAAAGG + Intronic
1058555280 9:106160162-106160184 ATTCTTTTAGTATGAATGAATGG + Intergenic
1058559541 9:106211249-106211271 ATTCATTTTCTCTGACAGAATGG + Intergenic
1058577728 9:106421571-106421593 ATTCACTTACCATGGAAGAAAGG + Intergenic
1058978904 9:110151063-110151085 GTTCATTTAATAAGTAAGTATGG - Intronic
1059851987 9:118352494-118352516 ATTAATTTACTATGAAAGCAGGG - Intergenic
1186925794 X:14332031-14332053 GATCATTTCCTAAGAAAGAAAGG - Intergenic
1189216376 X:39328358-39328380 GTTCCATTAATAAGAAAGAAGGG - Intergenic
1190997692 X:55627030-55627052 GTACATTTTCTTTAAAAGAATGG - Intergenic
1191007732 X:55728259-55728281 GTTCATTTGCCATGCAGGAATGG - Intronic
1192235827 X:69295389-69295411 GTCCATGTAAAATGAAAGAACGG + Intergenic
1193295037 X:79823839-79823861 TTCCATTTACTTGGAAAGAATGG - Intergenic
1193345715 X:80401603-80401625 GTGTATTTACTATAAAAGGATGG + Intronic
1193351275 X:80467524-80467546 TTTCATATACCATGTAAGAAAGG - Intergenic
1193864764 X:86718081-86718103 GTGCATTCACTATGACAGTATGG - Intronic
1194615737 X:96101421-96101443 GTTAATTTATTATTGAAGAAAGG + Intergenic
1195530063 X:105944140-105944162 TTTCATTAACTATAGAAGAATGG - Intronic
1198551699 X:137752059-137752081 CTTCTCTTACTCTGAAAGAAAGG + Intergenic
1199840491 X:151642287-151642309 GTTTTTTTACAATGTAAGAATGG - Intronic
1200294411 X:154903738-154903760 GTTCATTTGCTTTGAACAAATGG + Intronic
1200749697 Y:6933600-6933622 GTTCTTTCACGATGAAAGACAGG - Intronic
1201480670 Y:14436119-14436141 GTTTATTTTCTATTAAAGGAAGG + Intergenic
1201641493 Y:16182771-16182793 GGTAATTTACTATGACAGCAAGG - Intergenic
1201661322 Y:16402551-16402573 GGTAATTTACTATGACAGCAAGG + Intergenic
1202025153 Y:20513812-20513834 GTTCATTTACTATTAAAGAAAGG + Intergenic