ID: 941473295

View in Genome Browser
Species Human (GRCh38)
Location 2:165917234-165917256
Sequence GTAGGTCAAGTTTTAATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941473295_941473297 -4 Left 941473295 2:165917234-165917256 CCTTAAATTAAAACTTGACCTAC 0: 1
1: 1
2: 2
3: 36
4: 194
Right 941473297 2:165917253-165917275 CTACCTGCTCTCCATTTAAGCGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941473295 Original CRISPR GTAGGTCAAGTTTTAATTTA AGG (reversed) Intronic
903304820 1:22405855-22405877 GTAGGTCTATTTTTAATTTTTGG + Intergenic
905846692 1:41240129-41240151 ATATGTCAAGTTTTGATTTTAGG - Intronic
906309971 1:44746822-44746844 GTTGGTAAAGTTTGAATTTAGGG + Intronic
908926471 1:69260891-69260913 GAAGGACAAGTTTTATTTTGTGG - Intergenic
909128898 1:71710324-71710346 GTAGCTCAATTTTTAGTTTTAGG - Intronic
909545949 1:76846523-76846545 GTAGTTCTATTTTTAATTTTTGG + Intergenic
910979855 1:92949171-92949193 GAAGGTGAAGTTCTAATTTTGGG - Intronic
913667503 1:121061793-121061815 GTAAGTAAAGTTTTAATCTAGGG + Intergenic
913716837 1:121543800-121543822 GTAGGGAAAGGTTTGATTTAGGG + Intergenic
914019196 1:143848936-143848958 GTAAGTAAAGTTTTAATCTAGGG + Intergenic
914657745 1:149757143-149757165 GTAAGTAAAGTTTTAATCTAGGG + Intergenic
915053254 1:153100058-153100080 GTGCCTCAAGTTTTAATTTCTGG - Intronic
917292155 1:173481520-173481542 ATAGGTCAAGTTATAAATTATGG + Intronic
918671174 1:187218243-187218265 GTAGCTCAATTTTTACTTTTGGG + Intergenic
919431719 1:197502145-197502167 GTAACTCCAGTTCTAATTTAGGG - Intergenic
923782766 1:237040962-237040984 ATAGGTCAAGTTTTTAGGTAAGG + Intergenic
1062962481 10:1583138-1583160 ATAGGTCAAGTGTTGATCTATGG - Intronic
1063183594 10:3630265-3630287 CTACATCAAGTATTAATTTATGG + Intergenic
1063727292 10:8651934-8651956 GTTGGTCAAGTTTGAATTGGTGG - Intergenic
1064452048 10:15451379-15451401 GTTGTTCATGTTATAATTTATGG - Intergenic
1067895397 10:50174194-50174216 GTAGGCCTAGTTTTAAATTAAGG - Intergenic
1067953586 10:50767784-50767806 GTAGGCCTAGTTTTAAATTAAGG + Intronic
1068027006 10:51658516-51658538 GTAGGCCAGGTTTGAATCTAAGG - Intronic
1069380352 10:67837861-67837883 GTATTTCAAGTTTTTATTTAAGG - Intronic
1069487633 10:68834530-68834552 GTAGGTGAAATTTATATTTAGGG + Intronic
1072056103 10:91757707-91757729 GTAGGTCAGGTTTTAAATGCAGG - Intergenic
1074190459 10:111130801-111130823 AAAGGTTAAGTTTTAAGTTAAGG + Intergenic
1075674248 10:124285067-124285089 GTAGTTCTATTTTTAATTTTTGG - Intergenic
1079666010 11:23106251-23106273 GAATGTCAAATTTAAATTTATGG - Intergenic
1081970497 11:47195061-47195083 GAAGGTCAAGTTCTCATGTAAGG - Intergenic
1083099031 11:60283648-60283670 GTAGGTAAATTGTCAATTTATGG + Intronic
1083099144 11:60284920-60284942 GTTGGTAAATTGTTAATTTATGG - Intronic
1086495299 11:87398204-87398226 GTAGTTATAGTTTTATTTTATGG + Intergenic
1087601356 11:100320099-100320121 GTAGTTCCATTTTTAATTTTGGG + Intronic
1087652971 11:100889835-100889857 GTGGGTCAAGAGTTAAGTTAAGG - Intronic
1088517877 11:110658049-110658071 GTAGGTCAAGTTTCAAACTCAGG - Intronic
1089954664 11:122558868-122558890 GTAGTTCTATTTTTAATTTTTGG - Intergenic
1091663206 12:2399709-2399731 GGATGTGAAGTTTTCATTTAGGG + Intronic
1093047240 12:14461379-14461401 TTTGGTGAATTTTTAATTTATGG + Intronic
1096026806 12:48372819-48372841 GTAGTTCTATTTTTAATTTTGGG - Intergenic
1096548763 12:52358851-52358873 ATAGGCCAACTTTCAATTTAGGG - Intergenic
1096761040 12:53842192-53842214 TTAGTTCTAGTTATAATTTAGGG - Intergenic
1098045932 12:66400644-66400666 GAAGGTAAAGTATTGATTTATGG + Intronic
1099334719 12:81339965-81339987 GTTGGTTAAGTTTCAATTTATGG + Intronic
1100915590 12:99417247-99417269 TTAGGTCAAGTTTCAACTTGTGG + Intronic
1102262445 12:111452293-111452315 GTGGTTCAACTTTTAAGTTAAGG - Exonic
1102770914 12:115475033-115475055 GAAGGACAAGAATTAATTTATGG - Intergenic
1102906543 12:116680237-116680259 GTAGTTCTAGTTTTAATGTTTGG + Intergenic
1102955018 12:117053514-117053536 TTGGGTCAAGTTTTTTTTTAAGG + Intronic
1105843604 13:24276086-24276108 GTAGTTCTAGTTTTAATTTTTGG - Intronic
1106951503 13:34889809-34889831 GTAGCTCAAGGTTTAATGTCTGG + Intergenic
1107743674 13:43482090-43482112 GTAGTTCTATTTTTAATTTGTGG - Intronic
1107762409 13:43694666-43694688 GTAGGCAAAATTTTAATTTATGG + Intronic
1108087888 13:46814482-46814504 GGAAGTTAAATTTTAATTTATGG - Intergenic
1108467470 13:50731126-50731148 GTCGGCCAAGTCTTCATTTATGG + Intronic
1110714032 13:78681554-78681576 GTAGATCATTTTTTAATTAATGG - Intergenic
1111404975 13:87792113-87792135 GTAGTTCTATTTTTAATTTTAGG - Intergenic
1111577125 13:90169896-90169918 GTAGTTCTATTTTTAATTTTTGG - Intergenic
1111687851 13:91523191-91523213 GTAGTTCTATTTTTAATTTTTGG - Intronic
1115063078 14:29218131-29218153 ATAGTTGAAGTTTTAATTTAAGG + Intergenic
1119085427 14:71734570-71734592 TTTAGTCAAGTTTTAATTTTGGG + Intronic
1119874342 14:78044739-78044761 GTAGTTCTAGTTTTCATTTGTGG - Intergenic
1120520672 14:85524458-85524480 GTAGGTCAAGTTTATTTCTAGGG + Intergenic
1122010152 14:98739889-98739911 GTAGCTCTGGTTTTTATTTATGG - Intergenic
1124944931 15:34256202-34256224 GTAGGTCAAGGTTGTATTTCAGG - Intronic
1127507107 15:59608094-59608116 GTAGGTCAAGGTGTCATTTTTGG + Intronic
1127554577 15:60075058-60075080 GTAGGTCAAGTTTAAGTTGTAGG - Intergenic
1128823851 15:70690790-70690812 GTATCTCAAGTTTTAATTCTTGG - Intronic
1130387166 15:83422055-83422077 GTAGTTCTATTTTTAATTTTTGG + Intergenic
1130642219 15:85688401-85688423 GTAGGTCTAGTTTTATTGTATGG - Intronic
1131642217 15:94304748-94304770 GTATGTCAAGTTCTAATTTGTGG - Intronic
1138096299 16:54214549-54214571 TTAATTCAAGTTTTAATTTTGGG + Intergenic
1139045609 16:63055570-63055592 CTTTGTCAAGTTTTAATTTTAGG - Intergenic
1143215475 17:5221722-5221744 GTAGGTGAAGTTTTAGTTCTGGG + Intronic
1144710592 17:17399178-17399200 GCAGGTCTGCTTTTAATTTAAGG - Intergenic
1146968311 17:37051960-37051982 GTAAGTTAAATTTTAATTCAAGG + Intronic
1149979732 17:61300444-61300466 GTAGGGCAAGTTTTAATTTAGGG + Intronic
1150860386 17:68795379-68795401 GTAGGTCAAGGGTTAATTTTTGG - Intergenic
1154365476 18:13704382-13704404 TTATTTCAAGGTTTAATTTATGG - Intronic
1155412018 18:25556945-25556967 GTATGTCAAGAGTTAATTTCTGG + Intergenic
1156096420 18:33538138-33538160 TTAGTTCAATTTTAAATTTAGGG - Intergenic
1156398627 18:36720986-36721008 GTAGGTGAAGCATTAATTTTGGG - Intronic
1156643765 18:39134965-39134987 CTAAGTCAAATTTTAATTTTGGG + Intergenic
1159157501 18:64602864-64602886 GTAGGGCAAGGTTTATTTTAAGG + Intergenic
1160127421 18:76189340-76189362 GGAGGTGAAGTTCTCATTTAGGG - Intergenic
1163923782 19:20319593-20319615 GAAGGTCTAGTTTAAATTTAAGG - Intergenic
1164410054 19:27994800-27994822 CTAGGTCAATTTTTACTTTGTGG - Intergenic
1167773601 19:51540036-51540058 GTAGTTCCATTTTTAATTTTGGG - Intergenic
926432605 2:12804283-12804305 ATAGGCCTAGTTTTATTTTATGG + Intergenic
927034579 2:19160818-19160840 GTAGTTCTATTTTTAATTTTTGG + Intergenic
927129266 2:20043642-20043664 GCAGATCAAGTTTTATTTTAGGG + Intronic
928784076 2:34860803-34860825 GTAGCTCAACTTTTAGTTTTTGG - Intergenic
932857488 2:75252045-75252067 GTAGTTCTATTTTTAATTTTTGG + Intergenic
933332348 2:80909872-80909894 GTAGGTAAAGAATTAATTTAAGG + Intergenic
935493051 2:103744415-103744437 GTCTGTCAAGTTCTAATTTTAGG - Intergenic
939268885 2:139912412-139912434 GTAGATCAAGTTGTATTTAAAGG + Intergenic
939433312 2:142139888-142139910 CTATGACAAGTTTTCATTTAGGG + Intergenic
940107968 2:150119309-150119331 CTAAGTCCAGTTTAAATTTAAGG - Intergenic
940792185 2:158040812-158040834 GTAGGATAAGATTTGATTTAGGG + Intronic
941473295 2:165917234-165917256 GTAGGTCAAGTTTTAATTTAAGG - Intronic
941881742 2:170487454-170487476 CTACGTCAAGTTTTATTTAATGG + Intronic
943076332 2:183200019-183200041 GTAGTTCTAGATTTAATTTCTGG - Intergenic
943592932 2:189821059-189821081 GTTGGTCTTTTTTTAATTTAGGG - Intronic
944297209 2:198079868-198079890 TGAGGTTAAGCTTTAATTTAGGG + Intronic
944644823 2:201768473-201768495 TTATGTCCAGTTATAATTTAAGG - Intronic
945873266 2:215250344-215250366 GTAATTCTATTTTTAATTTAGGG - Intergenic
947158857 2:227191643-227191665 GTAGCTGAAGTTTTACATTATGG + Intronic
947764128 2:232624941-232624963 GTGGGGCAAGTTGTAATTTTAGG - Intronic
1169593484 20:7171635-7171657 GCAGGTCATTTTATAATTTAGGG + Intergenic
1173206646 20:41000294-41000316 GTAGTTCCATTTTTAATTTTGGG - Intergenic
1173384255 20:42573531-42573553 GTAGCCCAAGTTTGAATTGAAGG + Intronic
1176935607 21:14862950-14862972 TTAGGTTAGGTTTTAATTTATGG + Intergenic
1178179886 21:30147470-30147492 ATAGTTCATGTTTTAATTTATGG + Intergenic
1178905312 21:36631589-36631611 GTAGGTCAATTTTGAATGTCAGG - Intergenic
949280185 3:2336953-2336975 GTGGGTCAAGTATTAATTGATGG + Intronic
949649546 3:6140298-6140320 GTTTGTCAAGTTTAATTTTATGG + Intergenic
951546459 3:23830861-23830883 GTGGGTCAAGTTTTGTTCTAAGG + Intronic
951626234 3:24666836-24666858 GAAGGGCAAAATTTAATTTAAGG - Intergenic
951988876 3:28653243-28653265 GTAGTTCCATTTTTAATTTTTGG + Intergenic
952080537 3:29752398-29752420 GGATGTGAAGTTTTCATTTAGGG + Intronic
954120332 3:48494811-48494833 GTAGCTCTATTTTTAATTTTTGG + Intronic
956145399 3:66186578-66186600 GATGGTCAAGTTCAAATTTATGG - Intronic
957267423 3:77984953-77984975 GTAGCTCAATTTTTAGTTTTTGG + Intergenic
957907135 3:86571606-86571628 GTAGCTCTATTTTTAATTTTTGG + Intergenic
958576200 3:95952211-95952233 GTGAGTCAAGTTATAATTTCTGG - Intergenic
960675769 3:120193272-120193294 GTAGGTGAAGTTTTAAAATTTGG - Intronic
962128888 3:132651597-132651619 GTAGGTCAAGTATTGATTGAAGG - Intronic
962276522 3:134018684-134018706 CAAGGGCAAGTTTTATTTTAAGG + Intronic
962517413 3:136165446-136165468 GTCAGTCAATTTTAAATTTAAGG + Intronic
962951314 3:140221917-140221939 GTAGCTCTATTTTTAATTTTTGG - Intronic
963901938 3:150741438-150741460 ATAGTTCTAGTTTTAATTTGAGG + Exonic
964247413 3:154669738-154669760 GAATGTAAAGTTTTCATTTAGGG - Intergenic
964258007 3:154800623-154800645 ATGAGTCAAGTTTGAATTTAGGG + Intergenic
965338448 3:167456728-167456750 GAAGGTCTAGTTTTACATTAAGG - Intronic
965780786 3:172283817-172283839 GTATGTCAACTTTTGATTTATGG + Intronic
969864906 4:10068918-10068940 GTGGGTCAAGTATTCATTTAGGG + Intergenic
970059132 4:12010723-12010745 GTGGGTCTAGTTTTAAATTATGG - Intergenic
970514276 4:16812392-16812414 GTAGTTAAAGTTTTAACATACGG + Intronic
970922778 4:21414533-21414555 GTAGTTCTAGTTTTAATTTTTGG - Intronic
971406306 4:26323105-26323127 GTAGTTTGAGTTTTAATTAATGG + Intronic
973161471 4:47022772-47022794 GTAGCTCAATTTTTAGTTTGAGG - Intronic
974254091 4:59427206-59427228 GTAGTTCTATTTTTAATTTTTGG + Intergenic
974372796 4:61039807-61039829 TGAGGTCAAGTTTTAAAATATGG + Intergenic
975191932 4:71474222-71474244 GTATATCAATTTTTATTTTAAGG - Intronic
976798936 4:88966088-88966110 GTAGTTCTATTTTTAATTTTTGG + Intronic
977261453 4:94801712-94801734 TTAGTTTAAGTTTTAGTTTAAGG - Intronic
978727555 4:111987234-111987256 GTAAGAGAAGTTTAAATTTAAGG + Intergenic
979290056 4:118969528-118969550 GAAGGCCAACTTTTCATTTATGG + Intronic
980196469 4:129595422-129595444 GTAGTTCCATTTTTAATTTTGGG - Intergenic
981160853 4:141496923-141496945 GTAAGTGAAGTTATAATGTAGGG - Intergenic
981302843 4:143209281-143209303 GTAAATGAAGTTTTACTTTAAGG + Intronic
982827199 4:160016454-160016476 GTAGATAGAGTTTTATTTTAAGG + Intergenic
983440279 4:167773793-167773815 GTAGTTCCAGTTTTAAATTTGGG + Intergenic
983841822 4:172466362-172466384 AGAGGTAAAGTTTTAATTTCTGG + Intronic
986651694 5:9970545-9970567 GTAGCTCAATTTTTAGTTTTTGG - Intergenic
987510809 5:18835742-18835764 GGAGGTTAAATTTTAATTCAGGG - Intergenic
987998679 5:25319584-25319606 GTAGCTAAATGTTTAATTTATGG + Intergenic
990126172 5:52519968-52519990 GTAGTTCTATTTTTAATTTTTGG - Intergenic
990357007 5:54978251-54978273 TTAGGTGAATTTTCAATTTAAGG - Exonic
990689743 5:58350243-58350265 GTAGGTAAAGTTTGAATTTAAGG + Intergenic
992938662 5:81739207-81739229 CTAGGTCAAGTTGTCATTTAAGG + Intronic
994690585 5:103014601-103014623 GAAGGTCAAGTTTTACATAAGGG + Intronic
996226690 5:121008005-121008027 GCAAGTCATGTTTTAATTTCAGG + Intergenic
996482672 5:123992522-123992544 GCAGGTCAACTTTTCATTCAAGG - Intergenic
997171022 5:131720928-131720950 GTAGTTCTATTTTTAATTTTTGG - Intronic
998722790 5:144973922-144973944 AATGGTGAAGTTTTAATTTAGGG - Intergenic
1000414784 5:160972561-160972583 CTAGGTCCATTTTTATTTTAAGG - Intergenic
1000844286 5:166260181-166260203 CTAGCTTAAGTTTTAATCTATGG + Intergenic
1001841868 5:174883403-174883425 GTAGTTCTAGTTTTACTTTTTGG + Intergenic
1005767970 6:29033684-29033706 GTAGTTCTATTTTTAATTTTTGG + Intergenic
1006286056 6:33095281-33095303 GTGGGTGAAGTTCTAATTTTGGG + Intergenic
1007116962 6:39349606-39349628 GAAGGTCTAGGTTTAATTTGTGG + Intronic
1009611583 6:65949289-65949311 ATAAGTCAAGTTTAAATATATGG + Intergenic
1010485521 6:76407882-76407904 GTAGTTCTATTTTTAATTTTGGG + Intergenic
1010757187 6:79679618-79679640 GTAGTTCTATTTTTAATTTTGGG + Intronic
1013855699 6:114569461-114569483 GTAGTTCCATTTTTAATTTTTGG + Intergenic
1016134201 6:140518883-140518905 GTAGATCTATTTTTAATTTGGGG + Intergenic
1016522977 6:144967416-144967438 GTAGGTCAGTTTTTAAATTGCGG + Intergenic
1017284569 6:152659173-152659195 GTATGTAATGTTTTTATTTATGG + Intergenic
1020717674 7:11696724-11696746 GAAAGTAAATTTTTAATTTATGG + Intronic
1020889034 7:13855666-13855688 GTAGCTCAATTTTTAATTTTTGG + Intergenic
1021041696 7:15870891-15870913 GTATGACAAGTCTTTATTTAAGG - Intergenic
1021538385 7:21730076-21730098 GTAGCTCAATTTTTAATTTGAGG - Intronic
1024705565 7:51955478-51955500 GTAGTTCTATTTTTAATTTTTGG - Intergenic
1025765194 7:64439824-64439846 GTAGTTCTATTTTTAATTTTTGG + Intergenic
1026433515 7:70372126-70372148 GTAGCTCAAATTTTAAGTTGGGG - Intronic
1030831727 7:114232313-114232335 GTAGTTCTATTTTTAATTTTTGG - Intronic
1031230392 7:119098191-119098213 GTACTTCTAGTTTTAATTTTTGG + Intergenic
1033478098 7:141710333-141710355 GTTGGTCCAGTTTTGATATATGG + Intronic
1033934183 7:146562357-146562379 TTAGCACAAGTTTTAATTAATGG - Intronic
1036295358 8:7530382-7530404 TGAGGTCAAGTTTTAATTTCTGG + Intergenic
1036327212 8:7790636-7790658 TGAGGTCAAGTTTTAATTTCTGG - Intergenic
1036497464 8:9282529-9282551 GCAGGAAAAGTTATAATTTAAGG - Intergenic
1038711610 8:29951918-29951940 GCAGGTAAATTTTTATTTTATGG + Intergenic
1041054187 8:53965542-53965564 GTGGGTCAAATTGTAATTTGTGG - Intergenic
1042099586 8:65260478-65260500 GTAGCTCAATTTTTAGTTTTGGG + Intergenic
1043315643 8:78918156-78918178 GTAGCTCTAGTTTTAGTTTTTGG + Intergenic
1043700211 8:83277360-83277382 GTAATTCAATTTTTAATTTTTGG + Intergenic
1044487849 8:92773372-92773394 GTAGCTCTATTTTTAGTTTATGG + Intergenic
1044559681 8:93600783-93600805 GTAGAACAAATTTTAATATATGG - Intergenic
1052419351 9:28222492-28222514 CTAAGTCAAGTTTTAATTTAAGG - Intronic
1053032286 9:34791000-34791022 GTAGGCCAAGTTTAAACTTGGGG + Intergenic
1053214657 9:36260404-36260426 AAAAGTAAAGTTTTAATTTAGGG + Intronic
1058267084 9:102914838-102914860 GTAGTTCCATTTTTAATTTTTGG - Intergenic
1058915837 9:109564659-109564681 GTAGGTTAAAATTTAAATTATGG - Intergenic
1059012815 9:110481020-110481042 GTAGGACAAGATTCAGTTTAAGG - Intronic
1060382717 9:123191771-123191793 GTTTGTCAAGTCCTAATTTAGGG + Intronic
1186251157 X:7668314-7668336 GTTGGTCTAATTTTAATTTAGGG - Intergenic
1187588224 X:20687569-20687591 GTAGCTCAATTTTTAGTTTTTGG + Intergenic
1188053589 X:25515543-25515565 TTAAGTAAAATTTTAATTTATGG + Intergenic
1188491144 X:30740015-30740037 CTAGGGCAAGTTTTAATTTTGGG + Intergenic
1188647164 X:32583512-32583534 TTATGACAAGTTTTAATATATGG - Intronic
1188745228 X:33833136-33833158 GTAGCTCAATTTTTAGTTTTTGG + Intergenic
1188943932 X:36273987-36274009 GTAGTTCACGTTTTAATTGAAGG - Intronic
1189658576 X:43273818-43273840 GTAGATCTATTTTTAATTTGGGG + Intergenic
1191098884 X:56703983-56704005 TTACATCAAGTTATAATTTAAGG + Intergenic
1194125452 X:90011012-90011034 GTAGTTTTAGTTTTAATTTTTGG + Intergenic
1194241982 X:91461148-91461170 GTAGTTCTATTTTTAATTTTGGG - Intergenic
1194678007 X:96816673-96816695 GTAGCTCAATTTTAAATTTTTGG - Intronic
1195171727 X:102275218-102275240 GTAGCTCAATTTTTAGTTTTTGG + Intergenic
1195187133 X:102411875-102411897 GTAGCTCAATTTTTAGTTTTTGG - Intronic
1195612169 X:106880137-106880159 GTAGTTCTATTTTTAATTGAGGG - Intronic
1195632705 X:107075830-107075852 GTAGTTCTAATTTTAATTTTCGG - Intronic
1196068892 X:111497440-111497462 GTAGGCCAAGCTTATATTTAGGG - Intergenic
1196181412 X:112694893-112694915 GTAGATCTATTTTTAATTTGGGG + Intergenic
1198113146 X:133520601-133520623 CTAGGTCCAGTTTACATTTAAGG + Intergenic
1198180547 X:134203903-134203925 GGCCGTCAAGTTTTATTTTATGG - Intergenic
1198239517 X:134769457-134769479 GCAGGTCAAGTTTGAATAAAAGG - Intergenic
1198551540 X:137750262-137750284 GTAGGTCAAATTTTAACTGGTGG - Intergenic
1198618122 X:138480434-138480456 GTAGGTGAAGCTTTATTTGAGGG + Intergenic
1201264413 Y:12192269-12192291 GTAGGTAGAGATTTATTTTATGG - Intergenic
1201268585 Y:12232366-12232388 GTGTGGCAAGTTTTAATTAAAGG + Intergenic
1201466962 Y:14292920-14292942 GTTGGTCTAATTTTAAATTAGGG - Intergenic
1201505403 Y:14693881-14693903 ATATGTGAAGTTCTAATTTAGGG + Intronic