ID: 941473570 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:165920899-165920921 |
| Sequence | CAGTTTCACTCAAGGGAAGT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941473570_941473574 | 21 | Left | 941473570 | 2:165920899-165920921 | CCAACTTCCCTTGAGTGAAACTG | No data | ||
| Right | 941473574 | 2:165920943-165920965 | GTCTGTCTTTGTCAGAATTCTGG | No data | ||||
| 941473570_941473575 | 22 | Left | 941473570 | 2:165920899-165920921 | CCAACTTCCCTTGAGTGAAACTG | No data | ||
| Right | 941473575 | 2:165920944-165920966 | TCTGTCTTTGTCAGAATTCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941473570 | Original CRISPR | CAGTTTCACTCAAGGGAAGT TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||