ID: 941473570

View in Genome Browser
Species Human (GRCh38)
Location 2:165920899-165920921
Sequence CAGTTTCACTCAAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941473570_941473574 21 Left 941473570 2:165920899-165920921 CCAACTTCCCTTGAGTGAAACTG No data
Right 941473574 2:165920943-165920965 GTCTGTCTTTGTCAGAATTCTGG No data
941473570_941473575 22 Left 941473570 2:165920899-165920921 CCAACTTCCCTTGAGTGAAACTG No data
Right 941473575 2:165920944-165920966 TCTGTCTTTGTCAGAATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941473570 Original CRISPR CAGTTTCACTCAAGGGAAGT TGG (reversed) Intronic
No off target data available for this crispr