ID: 941477868

View in Genome Browser
Species Human (GRCh38)
Location 2:165970742-165970764
Sequence TACCTCCAAAGCATCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941477868_941477874 25 Left 941477868 2:165970742-165970764 CCAAAGGAGATGCTTTGGAGGTA No data
Right 941477874 2:165970790-165970812 CTGTAGGAGGTACATGTCACAGG No data
941477868_941477871 12 Left 941477868 2:165970742-165970764 CCAAAGGAGATGCTTTGGAGGTA No data
Right 941477871 2:165970777-165970799 CACCAGCACCATGCTGTAGGAGG No data
941477868_941477870 9 Left 941477868 2:165970742-165970764 CCAAAGGAGATGCTTTGGAGGTA No data
Right 941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941477868 Original CRISPR TACCTCCAAAGCATCTCCTT TGG (reversed) Intergenic
No off target data available for this crispr