ID: 941477870

View in Genome Browser
Species Human (GRCh38)
Location 2:165970774-165970796
Sequence GCTCACCAGCACCATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941477868_941477870 9 Left 941477868 2:165970742-165970764 CCAAAGGAGATGCTTTGGAGGTA No data
Right 941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941477870 Original CRISPR GCTCACCAGCACCATGCTGT AGG Intergenic
No off target data available for this crispr