ID: 941481754

View in Genome Browser
Species Human (GRCh38)
Location 2:166024102-166024124
Sequence GGTGGTGCATGCTACTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941481747_941481754 15 Left 941481747 2:166024064-166024086 CCGCGCCTGGCCAAAAATTTTTT 0: 6
1: 69
2: 508
3: 2521
4: 11839
Right 941481754 2:166024102-166024124 GGTGGTGCATGCTACTTTGGAGG No data
941481748_941481754 10 Left 941481748 2:166024069-166024091 CCTGGCCAAAAATTTTTTTAAAT 0: 4
1: 29
2: 143
3: 773
4: 3559
Right 941481754 2:166024102-166024124 GGTGGTGCATGCTACTTTGGAGG No data
941481749_941481754 5 Left 941481749 2:166024074-166024096 CCAAAAATTTTTTTAAATAGCTG No data
Right 941481754 2:166024102-166024124 GGTGGTGCATGCTACTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941481754 Original CRISPR GGTGGTGCATGCTACTTTGG AGG Intronic
No off target data available for this crispr