ID: 941482764

View in Genome Browser
Species Human (GRCh38)
Location 2:166038274-166038296
Sequence TTGGACTCCCTAGGAAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941482758_941482764 7 Left 941482758 2:166038244-166038266 CCCTAACCGTCTCAGGCTCATGG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 147
941482761_941482764 1 Left 941482761 2:166038250-166038272 CCGTCTCAGGCTCATGGCTAATT 0: 1
1: 0
2: 2
3: 15
4: 172
Right 941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 147
941482760_941482764 6 Left 941482760 2:166038245-166038267 CCTAACCGTCTCAGGCTCATGGC 0: 1
1: 0
2: 0
3: 16
4: 84
Right 941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941482764 Original CRISPR TTGGACTCCCTAGGAAAAGC TGG Intronic
901325810 1:8364462-8364484 TTGGGGTGCCCAGGAAAAGCTGG + Intronic
905311389 1:37051583-37051605 TTGGTCTCCCAGTGAAAAGCAGG - Intergenic
906643610 1:47457297-47457319 CTGGGCTCCCCAGGACAAGCAGG - Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
913126513 1:115795337-115795359 TTGCAGACCCCAGGAAAAGCAGG - Intergenic
915674082 1:157514813-157514835 GTGCACTCCCTAGGAAATCCGGG - Exonic
917268454 1:173246996-173247018 TTAGATTCCCTGGGAAAAGAAGG - Intergenic
917935572 1:179863447-179863469 TTTTAATCCCTAGGAAAGGCTGG - Intronic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921912505 1:220565544-220565566 TTGGATTGCCTATGAAGAGCGGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063470825 10:6283460-6283482 TTGGACTCAGTAGGCACAGCAGG - Intergenic
1064154729 10:12894495-12894517 ATGGACCTCCTAGGAAAGGCTGG - Intergenic
1071309750 10:84331258-84331280 TTGCACTCCCTCTGAAAAACTGG - Intronic
1071334998 10:84593458-84593480 TTGGAGTTCCTAGGAAAGTCAGG + Intergenic
1073456621 10:103640721-103640743 ATGGACTCCCTAAGGAATGCTGG + Intronic
1074086495 10:110211758-110211780 GGGGATTCCCTAGGAAAGGCAGG + Intronic
1075370446 10:121930395-121930417 TTCCATTCCCAAGGAAAAGCAGG + Intergenic
1075414613 10:122253168-122253190 TGGGAATCTCAAGGAAAAGCTGG + Intronic
1076858149 10:133127511-133127533 TTGGACTCCCTGGGAGAGGAGGG - Intronic
1077319265 11:1933872-1933894 GTGGACTCCCTCGGAGGAGCCGG + Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1082763991 11:57152045-57152067 TTGGCTTCCCTAGGAATAGGAGG + Intergenic
1082987022 11:59177878-59177900 TTGGAGTGCCTAGGACATGCAGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1089783410 11:120890887-120890909 GTGGCCTCCCTAGAAGAAGCTGG + Intronic
1089875940 11:121722463-121722485 CTGGACTCCCTCCGAGAAGCAGG - Intergenic
1092416374 12:8293258-8293280 TGGGCCTCCCTCAGAAAAGCGGG + Intergenic
1093415144 12:18911298-18911320 TTTGACTCCCTGGGCAAAGCTGG + Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1102530006 12:113539340-113539362 TTGGTCTCCCTGGGGGAAGCTGG + Intergenic
1102838269 12:116088434-116088456 TTGCCCTCCCAAGGAAAATCTGG + Intronic
1103509123 12:121462219-121462241 ATGGACAGCCCAGGAAAAGCTGG + Intronic
1104999065 12:132677114-132677136 TTGGACACTCGAGGGAAAGCTGG - Intronic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1107585510 13:41843300-41843322 TTAGACTCCCTTAGAAAAACAGG + Intronic
1108206625 13:48096243-48096265 TTGTTATCCCTAGGAAAAGTAGG - Intergenic
1109994873 13:70109516-70109538 TTGGAGTCCTTAGGCAAAGTTGG + Intergenic
1111469664 13:88662061-88662083 TTTGACTCTATAGGAAAAACAGG - Intergenic
1112001728 13:95216871-95216893 TTGTACGCCCTAGGAAATGAAGG + Intronic
1112810754 13:103216001-103216023 CTGGAAGCCCAAGGAAAAGCGGG - Intergenic
1113265756 13:108616368-108616390 TTCGAATCCCCAGGAAAACCGGG - Intronic
1114709860 14:24767272-24767294 TTGGACTCCCCTGAAAAAACAGG + Intergenic
1116371151 14:44134564-44134586 TTGGGATCCCTGGGAAGAGCTGG - Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1117329111 14:54695086-54695108 TTGGATTCACTAGAAAAGGCAGG - Intronic
1120734680 14:88039754-88039776 GTGGACTTCCTTGGAAAAGTTGG - Intergenic
1124386218 15:29210112-29210134 TTGGTCTGCATAGGAAAAGTGGG - Intronic
1127508363 15:59616368-59616390 TTGGACTCCCAAACAAAAGAAGG + Intronic
1130415213 15:83687481-83687503 TAGGACTTCCTGGGAAAAGGTGG + Intronic
1131053392 15:89362313-89362335 TGCGACTCCCAGGGAAAAGCTGG + Intergenic
1132119258 15:99162621-99162643 TAGGACTCCCTGCAAAAAGCTGG + Intronic
1133764127 16:8823845-8823867 TAGAAGTCCCTTGGAAAAGCTGG - Intronic
1134882046 16:17753499-17753521 TGGGACTCCCTCCGAAAATCCGG + Intergenic
1136513805 16:30755970-30755992 GTGGCCTTCCTAGGAAAACCTGG - Intronic
1139970007 16:70768461-70768483 TTGGACTCCCCAGGGAGAGGTGG - Intronic
1142181457 16:88672895-88672917 TGGGAATCCCAAGGAAATGCAGG - Intergenic
1142837695 17:2600845-2600867 TTAGCCTCCCTAGTAATAGCTGG + Intronic
1147735362 17:42634037-42634059 TTGGACTCCCAAGGCCAAGATGG - Intergenic
1152946769 17:83202170-83202192 TTGCATTCTCTAGGAGAAGCAGG - Intergenic
1155781591 18:29844485-29844507 TTGTATTCCCTGGGAGAAGCAGG - Intergenic
1156532840 18:37834941-37834963 ATGAAATCCCAAGGAAAAGCAGG + Intergenic
1156569370 18:38235560-38235582 TTGGACTACCGGGGAAATGCAGG - Intergenic
1161133167 19:2603731-2603753 TTGAACACGCTAGGAAAAACTGG - Intronic
1164845947 19:31432670-31432692 TTCAGCTCCCTAGGAAATGCTGG - Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926616887 2:15004939-15004961 CTGGATTCCTTAGGAAAAGCTGG + Intergenic
929290695 2:40187475-40187497 TTGGTCTCCCTGGGAACAGCAGG - Intronic
932232056 2:70090904-70090926 TTGAATGCCCTATGAAAAGCAGG + Intergenic
938983043 2:136544896-136544918 TTTGACTACCTATGAAAAGTTGG + Intergenic
940131394 2:150387185-150387207 CTGGGCTCAGTAGGAAAAGCTGG - Intergenic
940631168 2:156241106-156241128 TTGGACTCACCAGGATAATCTGG + Intergenic
941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
944207809 2:197175222-197175244 TGGGACTTCCTGAGAAAAGCCGG + Intronic
946047569 2:216833891-216833913 TGGGAGACCCTAGGAAAAGAAGG - Intergenic
947480654 2:230496856-230496878 TAGGTCTCCCTAGGGAAAGGAGG - Intronic
1169483885 20:6009993-6010015 TTTTCCTCCCAAGGAAAAGCAGG - Intronic
1174666740 20:52265138-52265160 TTGGACTCCCTCCGTGAAGCAGG - Intergenic
1175881244 20:62260503-62260525 TTGGCCGCCCATGGAAAAGCAGG - Intronic
1176150587 20:63588871-63588893 TTGGACTCACAAGGAAGACCAGG - Exonic
1178627151 21:34227680-34227702 TTGGACTCCCAGGGAAAAATAGG - Intergenic
1179091660 21:38271539-38271561 TTCAACTGCTTAGGAAAAGCAGG - Intronic
1182083580 22:27545832-27545854 TTGGTCTCCCAACAAAAAGCTGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951666361 3:25128118-25128140 TTAGAACCCCTAAGAAAAGCAGG - Intergenic
954116314 3:48468734-48468756 TTGGTCACCCTAGGGTAAGCTGG + Exonic
960810975 3:121627339-121627361 TGGGACTCCCCAGGGAACGCAGG + Exonic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961960761 3:130852523-130852545 TGGGACAACCTAGGAACAGCTGG + Intronic
962277947 3:134029997-134030019 TTTGACACCCGAGGAAAAGAGGG - Exonic
962868511 3:139467808-139467830 TTGGACTCCACAGGAGAAGTGGG + Intronic
963716454 3:148809714-148809736 TTGGACTACCTAATAAAAGTAGG - Intronic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967622197 3:191647812-191647834 TTTGACACCCCAGGAAAACCAGG + Intergenic
968318310 3:197742964-197742986 TTGCCCTCCCTAGGGAAGGCAGG - Intronic
968490563 4:888687-888709 TCCGACTCCCTGGGAGAAGCGGG + Intronic
977145931 4:93439934-93439956 TTTGACTACCTAGGAAATGGTGG - Intronic
978602479 4:110443371-110443393 TTGGAGTCACAGGGAAAAGCTGG + Intronic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
984244709 4:177261135-177261157 TTCGTTTCCCTAGGACAAGCTGG - Intergenic
985840929 5:2305234-2305256 TGTTACTCCCTAGGAAGAGCTGG - Intergenic
985960532 5:3299669-3299691 GAGGTCTCCCTAGGAAGAGCTGG - Intergenic
986173457 5:5332320-5332342 CTGGTCTCCCCAGGAAAACCAGG + Intergenic
987980370 5:25077114-25077136 TTGGACTCTCTACAAGAAGCTGG - Intergenic
992832376 5:80606688-80606710 TTGGACTCTCTAGGATAGGGAGG + Intergenic
995669581 5:114586585-114586607 TTGGAATTCCTAGAAAAAGTGGG - Intergenic
1000631598 5:163596712-163596734 TTTGATTCCCTAGGATAAGGAGG - Intergenic
1001531108 5:172462458-172462480 TTAGATTCCCCAGGAAATGCGGG - Intergenic
1003423968 6:5984113-5984135 TTCGATTCCCTGGGCAAAGCTGG - Intergenic
1008401753 6:51071302-51071324 TTGGAATCCCAAGGAAAATATGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018172436 6:161153114-161153136 CTGGGCACCCCAGGAAAAGCAGG + Intronic
1018953524 6:168393508-168393530 TGGGTCTCCCTTGGGAAAGCAGG + Intergenic
1019119379 6:169791014-169791036 CTGGAGTCCCTAGGAAATCCAGG - Intergenic
1021455363 7:20824238-20824260 TTGAACTCTCTAGGATAGGCTGG - Intergenic
1021957344 7:25839262-25839284 GTGGACTCCTCAGGAATAGCAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027912845 7:84274815-84274837 TGGAACTCCCTAGGCAAACCTGG + Intronic
1028471722 7:91213222-91213244 TAAGATTCCCTGGGAAAAGCAGG + Intergenic
1028728036 7:94111204-94111226 TAGGGCTCCCTAGCAAAATCAGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1034432459 7:151048014-151048036 TTTGACTCCCTAGGGAGAGAGGG + Intergenic
1034550406 7:151816858-151816880 TTGGTTTTCCTTGGAAAAGCTGG + Intronic
1043642629 8:82474649-82474671 TAGAACTCCCTAGGAAAAGAGGG - Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1047513745 8:125535651-125535673 TGGGACTACCTTGGAAAACCTGG + Intergenic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG + Intergenic
1050827130 9:9961242-9961264 TTGCACTCCCTATCAAAACCTGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056793304 9:89639956-89639978 TTGGAGTCCCTGAGAGAAGCTGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1061018951 9:128001507-128001529 TTCTACCCTCTAGGAAAAGCTGG - Intergenic
1061809077 9:133152023-133152045 TTGGTCACCCGTGGAAAAGCTGG - Intergenic
1062233877 9:135498882-135498904 TTGGCCTGCCTTGGAAGAGCAGG - Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192758044 X:74066576-74066598 TTGGTCACCCTAGGGTAAGCTGG - Intergenic
1193117188 X:77786365-77786387 TTGGACCCCCTGCGAAAAGGTGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1196960598 X:120996246-120996268 TATGAATCCCTAGAAAAAGCTGG + Intergenic
1198999335 X:142615653-142615675 TAGGACTTTCTAGAAAAAGCTGG - Intergenic
1201953297 Y:19589561-19589583 TTCGACTCCAGAGGAGAAGCTGG + Intergenic