ID: 941484555

View in Genome Browser
Species Human (GRCh38)
Location 2:166063506-166063528
Sequence TTCTCTTTAGAATGTAGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941484555_941484556 -7 Left 941484555 2:166063506-166063528 CCTGTGCTACATTCTAAAGAGAA No data
Right 941484556 2:166063522-166063544 AAGAGAAAACAAAGATACATAGG No data
941484555_941484557 22 Left 941484555 2:166063506-166063528 CCTGTGCTACATTCTAAAGAGAA No data
Right 941484557 2:166063551-166063573 CACCAAGACATTTATAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941484555 Original CRISPR TTCTCTTTAGAATGTAGCAC AGG (reversed) Intronic
No off target data available for this crispr