ID: 941489871

View in Genome Browser
Species Human (GRCh38)
Location 2:166129990-166130012
Sequence GACTCAGGACCAGGTGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941489866_941489871 -10 Left 941489866 2:166129977-166129999 CCCTCACCATGGGGACTCAGGAC 0: 1
1: 0
2: 3
3: 19
4: 182
Right 941489871 2:166129990-166130012 GACTCAGGACCAGGTGGACCAGG 0: 1
1: 0
2: 1
3: 28
4: 201
941489860_941489871 28 Left 941489860 2:166129939-166129961 CCACTACATGTGATTCTGGCAGC 0: 1
1: 0
2: 1
3: 4
4: 107
Right 941489871 2:166129990-166130012 GACTCAGGACCAGGTGGACCAGG 0: 1
1: 0
2: 1
3: 28
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941489871 Original CRISPR GACTCAGGACCAGGTGGACC AGG Intergenic
900098149 1:948714-948736 GCCTGAGGACCAGGGTGACCAGG - Intronic
900473379 1:2865142-2865164 GACTGAGGACCAGGAAGAACGGG + Intergenic
900530588 1:3151088-3151110 ATCTCAGGACCAGGAGGCCCAGG - Intronic
900562904 1:3316467-3316489 GATTCAGGACAGGGAGGACCTGG + Intronic
900692222 1:3987719-3987741 GGCTCAGAAACAGGTGGCCCAGG + Intergenic
900692256 1:3987844-3987866 GGCTCAGAAACAGGTGGCCCAGG + Intergenic
902368045 1:15990146-15990168 GACTCAGGATCTGGGGGTCCCGG - Intergenic
902403751 1:16172191-16172213 GTCTCAGGACCAGCTGCTCCCGG - Intergenic
902549621 1:17211627-17211649 AATTTAGAACCAGGTGGACCTGG - Intronic
902938574 1:19782804-19782826 GGCTCAGGACCAGACAGACCTGG + Intronic
903063327 1:20684930-20684952 GGCTCAGGCCCCGGTGGCCCTGG - Exonic
905765242 1:40595245-40595267 GACGAAGTACCAGGAGGACCTGG - Intergenic
905897706 1:41559260-41559282 GACTCAGAAGAAGGGGGACCAGG - Intronic
905975384 1:42170483-42170505 GACTCATTGCCAGGTGGACTGGG + Intergenic
907028872 1:51151218-51151240 GTCTCAGGAACAGGTGTAACAGG + Intergenic
912244859 1:107950771-107950793 CAGTCAAGACCAGATGGACCAGG + Intronic
915235675 1:154479216-154479238 GACTCAGGAAGAGATGGGCCAGG + Intronic
915314449 1:155020098-155020120 GCTCCAGGGCCAGGTGGACCAGG - Intronic
916561375 1:165936523-165936545 CACACAGGGCCAGGTGTACCAGG + Intergenic
916793620 1:168146013-168146035 GTCCCAAGACCAGGTGGACCTGG + Intergenic
916870249 1:168906191-168906213 GACTCAGAACCAGGAGGCCTGGG - Intergenic
921662622 1:217823497-217823519 GACTCAGGACTCTGTGGACAAGG + Intronic
922571736 1:226638388-226638410 GACTCAGTACCGGCTGGAACTGG - Intronic
922584503 1:226723326-226723348 GACTCAGGTCCAGGTGGCTCTGG - Intronic
922800264 1:228361875-228361897 GGCTGATGACCAGGTGGACGGGG + Intronic
923992929 1:239459095-239459117 GACACAGGAAGAGGTGGACAGGG + Intronic
924732476 1:246724503-246724525 GGCCCGGGAGCAGGTGGACCCGG + Exonic
1063940431 10:11123072-11123094 GACTGAGGACCGGGAGGAACTGG - Intronic
1067062475 10:43084903-43084925 GACTCAGCAGCAGGGGAACCAGG + Intronic
1068803799 10:61172245-61172267 AACTCAGGTGCAGGTGGCCCAGG - Intergenic
1069521238 10:69123689-69123711 GACTCAGAAGGAGGTGGAGCGGG + Exonic
1069808935 10:71144297-71144319 GACTCAGATCCAGGTGGCCAGGG + Intergenic
1071569703 10:86690257-86690279 GAGCCAGGACCAGGGAGACCTGG + Intronic
1072409276 10:95184905-95184927 GACACAGGAGCAGGTGGCCTGGG - Intergenic
1074242616 10:111654290-111654312 GCCTGAGGTCCAGGTGGACTGGG + Intergenic
1075379982 10:122011206-122011228 GACACAGGGCCAGGTGGAGAGGG + Intronic
1075464148 10:122638828-122638850 GGCTCAGGACCAGGGGCACTGGG - Intronic
1077270910 11:1680000-1680022 AACTCAGGACCCCGTGGACGGGG + Intergenic
1078066893 11:8084575-8084597 GCCTCAGGACCATGAGGACAAGG - Intronic
1081115420 11:39193223-39193245 GTCTTAAAACCAGGTGGACCTGG + Intergenic
1083642446 11:64152894-64152916 GCTGCAGGACCAAGTGGACCTGG + Intronic
1083953372 11:65969079-65969101 GATTCAGGACCCGGAGGACAGGG + Intronic
1085043823 11:73342269-73342291 GACACAGGACAAGCTGGATCCGG + Intronic
1085121709 11:73971576-73971598 TACGCAGGCCCAGTTGGACCTGG - Intergenic
1087153263 11:94877557-94877579 GACTCTGCAACAGGTAGACCTGG - Intergenic
1088764745 11:112963544-112963566 GACCCAGGGCCAGGCGGACTAGG - Intronic
1089321775 11:117631316-117631338 GACACAGGGCCTGTTGGACCCGG + Intronic
1089351504 11:117824079-117824101 GGCTCAGGGCCAGGTGGCCACGG - Intronic
1090716699 11:129437583-129437605 GACTGAGACCCAGGAGGACCTGG + Intronic
1092502868 12:9065216-9065238 CACTCAGGAGCAGGTGAGCCAGG + Intergenic
1092876320 12:12851194-12851216 TACTCAGTAGCAGGTGGACACGG - Intergenic
1102183286 12:110928972-110928994 GAGTCAGATTCAGGTGGACCAGG + Intergenic
1102488397 12:113273598-113273620 GACGCAGGACCAGGGGTTCCGGG - Exonic
1104045154 12:125157189-125157211 CACTCAGGACCAGGTGGACAGGG - Intergenic
1104098876 12:125587514-125587536 ATCACAGGACCAGGTGGTCCTGG + Intronic
1105329630 13:19403304-19403326 GACTCAGGGCCATGTGGTCAGGG + Intergenic
1105862206 13:24425734-24425756 GACTCAGGGCCATGTGGTCAGGG - Intronic
1106099609 13:26682836-26682858 GACCCGGGACCAGGAGGGCCTGG - Exonic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1108494400 13:51009378-51009400 GCCTCAGGACCAGGTAGGCTAGG - Intergenic
1110790466 13:79581836-79581858 GGCTCAGGCCCAGGGGGATCAGG + Intergenic
1114201480 14:20525108-20525130 GTCCCAGGACCATGTGGAGCTGG - Intergenic
1114565625 14:23630640-23630662 GACACAGGTCCAGGAGGTCCTGG + Intronic
1117466649 14:56000813-56000835 GAGTGAGGACCAGGTGGAAAAGG - Intergenic
1119328133 14:73774374-73774396 GCCTCATGACCAGGTGGGACAGG + Intronic
1120741508 14:88113633-88113655 GACTCAGGGCCAAGTGTGCCTGG + Intergenic
1122300728 14:100729551-100729573 GAGTCAGGGCCAGGAGGACAGGG + Intronic
1122631035 14:103107889-103107911 CACTCTGGATCAGGTGGAACAGG + Intronic
1123470002 15:20543000-20543022 GTCTCCGGACCAGGAGCACCTGG + Intergenic
1123648053 15:22457697-22457719 GTCTCCGGACCAGGAGCACCTGG - Intergenic
1123730296 15:23137996-23138018 GTCTCCGGACCAGGAGCACCTGG + Intergenic
1123748434 15:23335414-23335436 GTCTCCGGACCAGGAGCACCTGG + Intergenic
1124280812 15:28359291-28359313 GTCTCCGGACCAGGAGCACCTGG + Intergenic
1124301892 15:28552334-28552356 GTCTCCGGACCAGGAGCACCTGG - Intergenic
1125825184 15:42670359-42670381 GACACAGAGCCAGGTGGGCCAGG - Intronic
1125953856 15:43776275-43776297 AACTCAGGCCCAGCTGCACCTGG - Intronic
1127981129 15:64035970-64035992 GAATCAGAAACATGTGGACCAGG + Intronic
1129244604 15:74271797-74271819 GAGTGGGGCCCAGGTGGACCTGG + Intronic
1130644868 15:85715594-85715616 GGGTCAGTACCAGGTGGAGCTGG + Intronic
1130644885 15:85715729-85715751 GGGTCAGTACCAGGTGGAGCTGG + Intronic
1132548944 16:546454-546476 AACTCAGGACCAGGTCGTCCTGG - Intronic
1132554715 16:567400-567422 CCCTCAGGACCAGGAGGACCCGG + Intronic
1132641712 16:981165-981187 GACTCTGGACGAGCTGGGCCTGG + Intronic
1133412579 16:5580552-5580574 GAAGCAGGACCAGCTGGAGCTGG - Intergenic
1134018730 16:10907139-10907161 GGCTCTGGACCAGGCGGCCCCGG - Exonic
1134217573 16:12327866-12327888 TACTGAGGGCCAGGTGGACAGGG + Intronic
1136153312 16:28366080-28366102 GACACAGGAGCAGGTGGCCTGGG - Intergenic
1136209774 16:28749187-28749209 GACACAGGAGCAGGTGGCCTGGG + Intergenic
1138511427 16:57510653-57510675 GACCCAGCACCAGGTGTCCCTGG + Intergenic
1138574858 16:57901077-57901099 GACACAGGACCATGGGGGCCAGG - Intronic
1138917526 16:61485077-61485099 TACTCTAGACCAGGTGGCCCAGG + Intergenic
1141676563 16:85520882-85520904 GACCAAGGACCAAGTGGGCCTGG + Intergenic
1143635532 17:8162248-8162270 GACCCAGGCCCAGGTGGATGAGG - Exonic
1145279260 17:21456106-21456128 GACTGAGGCCCAGCAGGACCTGG + Intergenic
1145812273 17:27771536-27771558 GACTGATGACCAGGTCGGCCAGG - Intronic
1148338729 17:46860337-46860359 GGCTCAGGAGGAGGTGGGCCAGG + Intronic
1150229522 17:63542437-63542459 GAGTCAGGGCCAGGTGGGCCAGG + Intronic
1151466789 17:74290848-74290870 GATTCTGGCCAAGGTGGACCAGG + Intronic
1152407822 17:80107667-80107689 TGCTCAGCACCAGCTGGACCAGG + Intergenic
1152619415 17:81354538-81354560 GACTCAGGACCAGGAGGCGCTGG + Intergenic
1152949500 17:83220310-83220332 GAGTCAGCATCAGGTAGACCTGG - Intergenic
1153702669 18:7711868-7711890 GACTCAGCACCAGGGGGAAGGGG + Intronic
1154251840 18:12751215-12751237 CACTCAGGAGCATGTGGACAAGG + Intergenic
1155226481 18:23733818-23733840 GACTCATGATCAGGTAGCCCTGG - Intronic
1156812885 18:41273970-41273992 AACTCAGGGACAGGTGGAGCAGG + Intergenic
1157132195 18:45017208-45017230 GACCCAGGCCCAGGTGGTCTGGG + Intronic
1157503099 18:48204406-48204428 GGCTCAGAGCCAGGTGGAACTGG + Intronic
1158934038 18:62348246-62348268 GGCTCAGAAGCAGGTGTACCTGG - Exonic
1159080158 18:63727260-63727282 GACTAGGGACCAGGTGGGCCAGG - Intergenic
1160807963 19:1000880-1000902 GAGTCAGGACGAGGGGGACCCGG + Intronic
1160822869 19:1066579-1066601 AGCCCAGGACCAGGTGGACGTGG + Intronic
1160830422 19:1102137-1102159 GACTCAGGGCCGGGTTGACTTGG - Intergenic
1160924148 19:1535082-1535104 CACTCAGCACCAGTTGGGCCGGG - Exonic
1161405116 19:4087170-4087192 GTCTGAGGCCCACGTGGACCTGG - Intergenic
1161707485 19:5829003-5829025 GAGTGAGGTCCAGGTGGACCTGG + Intergenic
1161726820 19:5934062-5934084 GACTCTGGCCCAGGGGGAGCTGG - Intronic
1162551817 19:11362207-11362229 GACTCCGGACCAGGGACACCTGG + Intronic
1162718110 19:12646694-12646716 AACTCCGTACCAGCTGGACCCGG - Exonic
1162734226 19:12737083-12737105 GAGTCAGGCCAAGGAGGACCGGG + Intergenic
1163148354 19:15397381-15397403 GGCTCAGGCCCAGGTGGAAGTGG - Intronic
1163419310 19:17205376-17205398 CACTCACGGCCAGGTGCACCAGG + Intronic
1164532880 19:29061458-29061480 GACTCAGGACCTGAGAGACCTGG + Intergenic
1164812495 19:31168792-31168814 GGCTCAAGACCAGCTGGCCCAGG - Intergenic
1164853060 19:31500590-31500612 GACTCAGGACCCCGTGCACGGGG + Intergenic
1166457112 19:42950848-42950870 TTCTTAGGACCAGGTGGAGCTGG - Intronic
1167036128 19:46995969-46995991 TACTCAGGAGCACCTGGACCAGG + Intronic
1168311611 19:55463633-55463655 GCCTCAGGTCCAGCTGGCCCAGG + Intergenic
1168401807 19:56089526-56089548 GGCTCAGGACCAGGTGTCCAGGG - Intronic
1168645023 19:58054067-58054089 GACTCAGGGCCGGGTGGCCGAGG - Exonic
930530802 2:52585946-52585968 GATTCAGGACAAGGTGAAACTGG + Intergenic
932761342 2:74440736-74440758 GACTCAGAAGCTAGTGGACCTGG - Intronic
936247459 2:110840881-110840903 GACTCTGGCCCAGGTGGCCTGGG + Intronic
938108943 2:128551597-128551619 GAGTAGGGACCAGGAGGACCAGG + Intergenic
941489871 2:166129990-166130012 GACTCAGGACCAGGTGGACCAGG + Intergenic
942042886 2:172082643-172082665 ACCTCAGGACCAGGAGGTCCTGG - Intergenic
942044194 2:172089950-172089972 GGCTCAGGAACAGGTGCATCAGG + Intergenic
942233649 2:173883224-173883246 GACTCAGGACTTGGTGGAGGAGG - Intergenic
942725495 2:179002264-179002286 TACTCAGTAGCAGGTGGACATGG - Intronic
948571331 2:238919441-238919463 GACTGAGCACCAGGGGGACGTGG - Intergenic
948703875 2:239777647-239777669 GACTCAGGCCAGGGTGGGCCGGG - Intronic
948928583 2:241115956-241115978 GCTTGAGGACCAGGTGGCCCCGG - Intronic
1169124395 20:3116523-3116545 GACTCAGGACCACGCTGACTAGG - Intronic
1172442172 20:34973549-34973571 GACTCAGGCAGAGGTCGACCAGG - Intergenic
1172790510 20:37502106-37502128 TTCCCAGGACCAGGTGGAGCTGG - Intronic
1173438911 20:43057726-43057748 AACTCAGAACCTGGTGGTCCAGG - Intronic
1174517201 20:51101753-51101775 GTCTCGGGGCCAGGCGGACCTGG - Intergenic
1179932508 21:44579695-44579717 GAGTCAGGACCAGTTGGCCCTGG + Exonic
1179998659 21:44985332-44985354 AACTCAGGCCCATGTGGAACAGG + Intergenic
1180701859 22:17785578-17785600 GGCTCAGGACTAGGTGGATGGGG - Intergenic
1181403820 22:22667909-22667931 GACTCAGCAGCAGGTGGCCCAGG - Intergenic
1181406143 22:22686345-22686367 GACTCAGCAGCAGGTGGCCCAGG - Intergenic
1181414095 22:22747005-22747027 GACTCAGCAGCAGGTGGCCCAGG - Intronic
1181426919 22:22849735-22849757 GACTCAGCAGCAGGTGGGCCAGG - Intronic
1181511713 22:23392392-23392414 GCTTCAGGACCAGGTGGAAGGGG + Intergenic
1181777827 22:25172243-25172265 GACTCAGGACCTGTGGGACCTGG + Intronic
1183779574 22:39990071-39990093 GACTCAGGACCAGAGAGACCGGG + Intergenic
1184342658 22:43894459-43894481 GGCAAAGGACCGGGTGGACCAGG - Intergenic
1184729234 22:46363940-46363962 GACTCAGGACAAGGGGGAAGTGG + Intronic
1185210699 22:49569082-49569104 AACTCAGGCCGTGGTGGACCAGG + Intronic
1185411222 22:50683944-50683966 CACTGATGACCAGGTGGACGTGG + Intergenic
949133444 3:534206-534228 GACTCAGGATAAGGTGGAGCTGG + Intergenic
949205908 3:1439279-1439301 AGCTGAGGACCAGGGGGACCTGG - Intergenic
952416513 3:33095671-33095693 GAACCAGGAACAGGTGGACAGGG - Intronic
954181575 3:48885376-48885398 GATTCAGGACCTGGGAGACCAGG + Intronic
954414079 3:50384489-50384511 GACTCAGGGACAGATGGACACGG + Intronic
955868289 3:63409032-63409054 GAGTCAGGACAAGGTTCACCTGG - Intronic
956605419 3:71068479-71068501 AACTGAGGACCACGTGGGCCAGG - Intronic
956844474 3:73169845-73169867 GACTCAGGAGCAAGTTGGCCTGG - Intergenic
957394985 3:79624830-79624852 AACTCTGGATCAAGTGGACCTGG + Intronic
958785448 3:98593009-98593031 GACCCAGGCCCAGGTGTGCCAGG - Exonic
959008555 3:101048195-101048217 GGCTCTGAACCAGGTAGACCTGG - Intergenic
963013700 3:140800764-140800786 AGCTCTGGACCAAGTGGACCTGG - Intergenic
964645729 3:158956777-158956799 GACTGGGGCCCAGGTGGTCCTGG + Intergenic
968222222 3:196947690-196947712 AAAGCAGGACCAGGGGGACCAGG + Exonic
969447795 4:7255559-7255581 GTCTCTGGACCACGTGGACAGGG - Intronic
969696359 4:8737352-8737374 GCCTCAGGAGCAGCGGGACCTGG + Intergenic
973330189 4:48905070-48905092 GACTCTGGGGCAGGAGGACCAGG + Intronic
973927945 4:55758976-55758998 GAGTCAGGGCCAGGTGGCTCAGG + Intergenic
981187063 4:141816165-141816187 GGCTCAGGACCAGGGAGATCAGG - Intergenic
985941840 5:3142481-3142503 GTCTCAGGACCCCGTGGGCCAGG - Intergenic
986298341 5:6457749-6457771 TCCTCAGGACCAGGTGGCTCTGG - Intronic
991989851 5:72326700-72326722 GTCTCGGGACCATGTGGAACTGG + Exonic
999722974 5:154412511-154412533 GACTCAGGTGCAGGTGGTCCAGG - Intronic
1003741665 6:8947325-8947347 GCCTCAGGATCAGGGGAACCAGG + Intergenic
1004319526 6:14621586-14621608 GACACATGACCAGAGGGACCTGG + Intergenic
1006296677 6:33172954-33172976 GAGTCTGGGTCAGGTGGACCGGG + Intronic
1006814021 6:36839008-36839030 GACACAGGAACAGGGGGTCCAGG - Intronic
1011944208 6:92880758-92880780 GACTCAGGACCAAGGAGATCGGG - Intergenic
1015117785 6:129668501-129668523 GAATCGGGACCAGATGGACCAGG - Intronic
1015732028 6:136358847-136358869 GAATCAGGAGCTGGGGGACCGGG + Intronic
1016844284 6:148555960-148555982 GGCTGAGGGCCAGGTGGATCAGG - Intergenic
1018427943 6:163700186-163700208 GACCCAGGAGCAGATGGAGCCGG + Intergenic
1018935527 6:168271639-168271661 GACTCAGGTGCTGGAGGACCAGG + Intergenic
1018964794 6:168475909-168475931 CAGGCAGGAGCAGGTGGACCAGG + Intronic
1028937903 7:96486483-96486505 GACACAGGGCCAGGTGGAACAGG - Intronic
1029706296 7:102278083-102278105 GCCTCAGCTCCAGGTGGACCAGG + Intronic
1030244148 7:107362411-107362433 CACTCATAACCAGGGGGACCTGG - Exonic
1034546336 7:151792018-151792040 GAGCTAGGAGCAGGTGGACCTGG - Intronic
1034554200 7:151839676-151839698 AAGTCAGGACCAGGTGTCCCTGG - Intronic
1034871350 7:154686921-154686943 GACCCGGAACCCGGTGGACCTGG - Intronic
1035090386 7:156305442-156305464 GCCTCAGGACCGGGTGCAGCAGG + Intergenic
1035115813 7:156523034-156523056 GTCTGAGGACCAGGTAGACATGG + Intergenic
1035616890 8:1008831-1008853 GAATCAGGACTAGGAGGCCCGGG - Intergenic
1037994443 8:23342158-23342180 GACTCAGGTCTAGGTGGTACAGG - Intronic
1038406998 8:27329530-27329552 GTCTCAGGACCATGTGACCCTGG + Intronic
1039702826 8:39979114-39979136 AGCTCAGGACCAGGTGGGCCAGG - Exonic
1043247610 8:78025312-78025334 GATTCAGGAGCAGGTTTACCAGG + Intergenic
1044848845 8:96408403-96408425 GACTCATGCCCTGGAGGACCAGG - Intergenic
1047104797 8:121720397-121720419 GGCTCAGGCCCAGGTGGGCAGGG + Intergenic
1047162103 8:122392182-122392204 AAATCAGAGCCAGGTGGACCTGG - Intergenic
1047803622 8:128335655-128335677 GATTCATGACAAGGTGGAACTGG + Intergenic
1047855102 8:128900984-128901006 CACTCAGGGCCAAGGGGACCTGG + Intergenic
1048172025 8:132116479-132116501 GACTCAGGGGTAGGTGGTCCTGG + Intergenic
1049237124 8:141518043-141518065 GCCTCATCACCAGGTGGCCCTGG + Intronic
1051638234 9:19200812-19200834 TACTCAGTAGCAGGTGGACATGG + Intergenic
1056103322 9:83322089-83322111 GACTTATGACCAGGGAGACCAGG + Intronic
1060968381 9:127724192-127724214 GACCGAGGACCAGGAGGACATGG + Exonic
1061715841 9:132518403-132518425 GCCTCAGGGCCAGGGGAACCCGG + Intronic
1061926485 9:133808433-133808455 GTCCCAGGGCCAGGTTGACCAGG + Intronic
1062204175 9:135326545-135326567 GACTTAGGACAAGGTGGGCCAGG + Intergenic
1188162327 X:26819336-26819358 GACTCAGGACTTGGTGTACTGGG + Intergenic
1189571905 X:42306957-42306979 GGCTCAGGCCCAGGGGGACCTGG - Intergenic
1190687372 X:52887282-52887304 GACTGAGGCCCAGGTGGGCCTGG - Intergenic
1190698610 X:52968510-52968532 GACTGAGGCCCAGGTGGGCCTGG + Intronic
1192559985 X:72121550-72121572 GACTCAGGACCAAGAGGAAGAGG + Intergenic
1197839947 X:130735479-130735501 GACACAGAACCAGAGGGACCAGG - Intronic
1198533672 X:137567237-137567259 CACGCAGCCCCAGGTGGACCTGG - Exonic
1199473766 X:148223880-148223902 GACTCAGAGTCAGGTTGACCCGG + Intergenic
1199661356 X:150053800-150053822 GACTCAGGACCAAGCTGACCTGG + Intergenic
1200070231 X:153525609-153525631 GGCTCAGGAGCAGCTGGTCCTGG + Intronic
1201504683 Y:14685117-14685139 GACTAATGACAAGGTGGAACAGG - Intronic