ID: 941494521

View in Genome Browser
Species Human (GRCh38)
Location 2:166183213-166183235
Sequence TCTAGTAACCACACTTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941494521_941494524 0 Left 941494521 2:166183213-166183235 CCCTCCTAAGTGTGGTTACTAGA No data
Right 941494524 2:166183236-166183258 CAAAAAGCCTCAGCATTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941494521 Original CRISPR TCTAGTAACCACACTTAGGA GGG (reversed) Intergenic
No off target data available for this crispr