ID: 941495776

View in Genome Browser
Species Human (GRCh38)
Location 2:166200386-166200408
Sequence TCTCCTTTTTACTAAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941495774_941495776 14 Left 941495774 2:166200349-166200371 CCAAAGAGAAATGACTAACATTA No data
Right 941495776 2:166200386-166200408 TCTCCTTTTTACTAAGTTCATGG No data
941495775_941495776 -9 Left 941495775 2:166200372-166200394 CCATTGTGACATTTTCTCCTTTT No data
Right 941495776 2:166200386-166200408 TCTCCTTTTTACTAAGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941495776 Original CRISPR TCTCCTTTTTACTAAGTTCA TGG Intronic
No off target data available for this crispr