ID: 941499905

View in Genome Browser
Species Human (GRCh38)
Location 2:166261273-166261295
Sequence CTGAGGCAGGACATTTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941499905_941499913 0 Left 941499905 2:166261273-166261295 CCCAGATAAATGTCCTGCCTCAG No data
Right 941499913 2:166261296-166261318 CCAGGCTACCTTGTTGTTAGGGG No data
941499905_941499914 3 Left 941499905 2:166261273-166261295 CCCAGATAAATGTCCTGCCTCAG No data
Right 941499914 2:166261299-166261321 GGCTACCTTGTTGTTAGGGGTGG No data
941499905_941499910 -2 Left 941499905 2:166261273-166261295 CCCAGATAAATGTCCTGCCTCAG No data
Right 941499910 2:166261294-166261316 AGCCAGGCTACCTTGTTGTTAGG No data
941499905_941499911 -1 Left 941499905 2:166261273-166261295 CCCAGATAAATGTCCTGCCTCAG No data
Right 941499911 2:166261295-166261317 GCCAGGCTACCTTGTTGTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941499905 Original CRISPR CTGAGGCAGGACATTTATCT GGG (reversed) Intronic
No off target data available for this crispr