ID: 941505250

View in Genome Browser
Species Human (GRCh38)
Location 2:166336163-166336185
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941505247_941505250 -2 Left 941505247 2:166336142-166336164 CCTGTGCTTTTGGTGTTCCCTTA No data
Right 941505250 2:166336163-166336185 TAGCCAAACCTGCTAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr