ID: 941509509

View in Genome Browser
Species Human (GRCh38)
Location 2:166388136-166388158
Sequence ATGTTGTCATTTATGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941509508_941509509 25 Left 941509508 2:166388088-166388110 CCAAGTGGAAGTATTTAGGAAGA No data
Right 941509509 2:166388136-166388158 ATGTTGTCATTTATGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941509509 Original CRISPR ATGTTGTCATTTATGAAAAA TGG Intergenic
No off target data available for this crispr