ID: 941510933 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:166408338-166408360 |
| Sequence | GCTTTTAAATGGATTGTTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941510933_941510936 | -7 | Left | 941510933 | 2:166408338-166408360 | CCATCAACAATCCATTTAAAAGC | No data | ||
| Right | 941510936 | 2:166408354-166408376 | TAAAAGCCGGTTTCTGTCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941510933 | Original CRISPR | GCTTTTAAATGGATTGTTGA TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||