ID: 941510933

View in Genome Browser
Species Human (GRCh38)
Location 2:166408338-166408360
Sequence GCTTTTAAATGGATTGTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941510933_941510936 -7 Left 941510933 2:166408338-166408360 CCATCAACAATCCATTTAAAAGC No data
Right 941510936 2:166408354-166408376 TAAAAGCCGGTTTCTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941510933 Original CRISPR GCTTTTAAATGGATTGTTGA TGG (reversed) Intronic
No off target data available for this crispr