ID: 941513749

View in Genome Browser
Species Human (GRCh38)
Location 2:166445944-166445966
Sequence TACGATTCAGAACATAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941513747_941513749 -2 Left 941513747 2:166445923-166445945 CCTAGAAGAAAACCTAGGCAATA 0: 8506
1: 11179
2: 4881
3: 2884
4: 2254
Right 941513749 2:166445944-166445966 TACGATTCAGAACATAAGCATGG No data
941513744_941513749 14 Left 941513744 2:166445907-166445929 CCTAAAACCATAAAAACCTAGAA 0: 28
1: 134
2: 184
3: 1105
4: 15411
Right 941513749 2:166445944-166445966 TACGATTCAGAACATAAGCATGG No data
941513745_941513749 7 Left 941513745 2:166445914-166445936 CCATAAAAACCTAGAAGAAAACC 0: 27
1: 138
2: 164
3: 131
4: 550
Right 941513749 2:166445944-166445966 TACGATTCAGAACATAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941513749 Original CRISPR TACGATTCAGAACATAAGCA TGG Intronic
No off target data available for this crispr