ID: 941517309

View in Genome Browser
Species Human (GRCh38)
Location 2:166494921-166494943
Sequence GTTTGGGAGTGAAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941517309 Original CRISPR GTTTGGGAGTGAAGGCCAGA GGG Intergenic
900243410 1:1627242-1627264 GTCTGAGAGTGAGGGGCAGAGGG + Intronic
900849650 1:5132266-5132288 TTTTGGCAGTGAAGGCTAAAGGG + Intergenic
901200708 1:7465549-7465571 GTTCTGGAGTGAGGGCCCGAGGG + Intronic
901365944 1:8748351-8748373 GTGTGAGAGTGAATGACAGAGGG - Intronic
901490569 1:9594429-9594451 GCTTGGGAGAGAAGGGGAGATGG - Intronic
902664114 1:17925598-17925620 GCTTGGGAGAGAAGGAGAGATGG - Intergenic
902944626 1:19825920-19825942 GTTTGGGAGGGCAAGGCAGATGG - Intergenic
903456412 1:23490261-23490283 TTCTGGGAGTGCAGGCCAGTAGG + Intergenic
904596654 1:31650691-31650713 GGTTGGCTTTGAAGGCCAGAGGG - Intergenic
904878050 1:33671630-33671652 GTACGGGAGTGAGGGCCAGGTGG - Intronic
906115210 1:43352230-43352252 GTCTGGAAGTGAGGGCCACAGGG - Exonic
906140914 1:43532839-43532861 GTGTGGAAATGAAGGCAAGAGGG - Intronic
908582516 1:65530781-65530803 GTTTGGGAATGCAGCCCAGTAGG + Intronic
908728632 1:67203389-67203411 GTCTGGAAGTAGAGGCCAGATGG - Intronic
909935956 1:81550925-81550947 GTTTGGGTGTGAACTCCACAGGG + Intronic
910061608 1:83100021-83100043 GTTTGGGAATGAATACTAGAAGG - Intergenic
911350823 1:96752834-96752856 GTTTGGAAGTGATGAGCAGACGG + Intronic
911471498 1:98324319-98324341 GCTTGGGCATGAAGTCCAGAGGG - Intergenic
914821418 1:151107092-151107114 AATGGGGAGTGGAGGCCAGAGGG + Exonic
914978860 1:152394236-152394258 GCTTGGGAGAGAAGGCAGGAGGG + Intergenic
919075126 1:192803974-192803996 GTTTGGGAGAGAAATCCACAAGG + Intergenic
920710823 1:208293413-208293435 TTTTAGGAGTGAAGGTCAGATGG + Intergenic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
922480693 1:225938594-225938616 CTTTGGGAGTGGAGGCCAGCGGG - Intronic
922502725 1:226109200-226109222 ATTTTTGAGTAAAGGCCAGAGGG - Intergenic
922582764 1:226710904-226710926 GTTTGTAAGTGAAGTCCAGTGGG - Intronic
923426740 1:233877768-233877790 GTTTGAGTTTGAAGGCCAGTAGG - Intergenic
924637112 1:245798787-245798809 AATAGGTAGTGAAGGCCAGAAGG - Intronic
1063332348 10:5173419-5173441 GTTTGGGACTGAAGGCTTGGAGG + Intergenic
1064475012 10:15678648-15678670 GTGTGGGAGTGAGAGGCAGAGGG + Intronic
1065171456 10:23034656-23034678 GAGTGGGAGCGAAAGCCAGATGG - Intronic
1065584989 10:27209166-27209188 GTTTGGGAGTCCAGGGCAGGTGG - Intronic
1065988030 10:30976496-30976518 CTTTGGGAGGCTAGGCCAGAAGG + Intronic
1069617932 10:69818066-69818088 GTTTGGGAGAGAAGGCAGGTGGG - Intronic
1069780606 10:70953101-70953123 GGTTGGGAGTGGAAGGCAGATGG - Intergenic
1070756107 10:78994193-78994215 GAGTGGCAGTGAAGGGCAGATGG + Intergenic
1071850936 10:89569719-89569741 TTTTGGGAGGCCAGGCCAGAAGG + Intergenic
1072773146 10:98160773-98160795 GTTAGAGTGTGAAGGACAGAAGG - Intronic
1073778096 10:106808378-106808400 GCATGGGAGTGAGGGCCAGGAGG - Intronic
1075086653 10:119418360-119418382 GCTGGGGAGTGATTGCCAGAGGG + Intronic
1075231721 10:120685560-120685582 CATTGGGAGTTAAGGCCAGAAGG - Intergenic
1075645541 10:124093595-124093617 GTTTGGGAGTGACGTGCAGACGG + Exonic
1075666517 10:124234439-124234461 TTTTGTAAGTGAAGTCCAGATGG + Intergenic
1076421572 10:130335799-130335821 CATTGGAAGTGAAGGCCAGCAGG + Intergenic
1076673668 10:132136676-132136698 ATTTGGGAGAGGAGGCCACATGG + Intronic
1077330157 11:1980647-1980669 GTTAAGGAGTTAAGGCCAGAAGG - Intronic
1079954952 11:26850911-26850933 GTGCGGGAGGGAAGGACAGAAGG - Intergenic
1083160351 11:60850496-60850518 GTGTGGGACAGAAGCCCAGAGGG + Exonic
1083485276 11:62979626-62979648 GCTTGGGAGTGGAGGCTAGGAGG + Intronic
1084155592 11:67311022-67311044 GTCTGGGACTCAAGGCCAAATGG + Intronic
1084322976 11:68383886-68383908 TTTTGGGAGTGGAGCCTAGAGGG + Intronic
1085232224 11:74982227-74982249 TTTTGGGGGTGTAGGCCATAAGG - Intergenic
1089004530 11:115079958-115079980 GTTTGGGAGGTGATGCCAGAAGG + Intergenic
1089115328 11:116090209-116090231 GCTTGGGAGAGAAGGGCAGTGGG - Intergenic
1089364127 11:117910648-117910670 GTGTGGGAGTAAAGGGCAGAGGG - Intronic
1090247023 11:125223849-125223871 GGCTGTGAGTGAAGGCCACAAGG + Intronic
1090413765 11:126526898-126526920 GTTAGGGACTGATGGGCAGAGGG - Intronic
1090830915 11:130420340-130420362 GGCTTGGAGAGAAGGCCAGATGG + Intronic
1202813134 11_KI270721v1_random:35826-35848 GTTAAGGAGTTAAGGCCAGAAGG - Intergenic
1092336898 12:7641231-7641253 GTTTCAGAGTGCACGCCAGAGGG - Intergenic
1092524980 12:9304367-9304389 CTTTTAGAGTGAAGGCCACAGGG + Intergenic
1092542288 12:9427451-9427473 CTTTTAGAGTGAAGGCCACAGGG - Intergenic
1093501785 12:19821436-19821458 GTTTGGTAGTGATGGCCAAATGG + Intergenic
1094348835 12:29500240-29500262 GCTTGGCTGTGAAGGGCAGACGG + Intergenic
1094510726 12:31094982-31095004 CTTTTAGAGTGAAGGCCACAGGG + Intronic
1096653214 12:53072420-53072442 GTTGGGGTGGAAAGGCCAGAGGG + Intronic
1096672661 12:53209483-53209505 GTTGGGGACAGAAGGCCAGAGGG + Intergenic
1098434946 12:70458720-70458742 GTTAGGGTGAGAAGGCAAGAAGG + Intergenic
1098999913 12:77167413-77167435 GTTTGGATGTGACGTCCAGAAGG - Intergenic
1099201077 12:79677975-79677997 GTTTGGGGGTAGAGGGCAGATGG - Intronic
1100447508 12:94675206-94675228 GTCTGGGAGAGAAAGCAAGATGG - Intergenic
1100997006 12:100312302-100312324 TTTTGGGATTGAAGGCGTGATGG + Intronic
1101479108 12:105079766-105079788 GATTGGGAGTGATGGTCAAAAGG - Intronic
1101538123 12:105639330-105639352 GTTTGGGAGGCCAGGGCAGATGG - Intergenic
1102724988 12:115054625-115054647 GTTTGGGAGTGAAGTTAAGGTGG - Intergenic
1104300174 12:127557827-127557849 GTTTGGGAGTCAAGGGGAGATGG - Intergenic
1104953079 12:132451153-132451175 GTTTTCCAGTGCAGGCCAGAGGG + Intergenic
1105023379 12:132832887-132832909 GATAGGGAGTGAATGCAAGAAGG - Intronic
1106057156 13:26249135-26249157 GTATAGGAGAGGAGGCCAGAGGG - Intergenic
1110046558 13:70840550-70840572 GTCTGGGAATGCAGGCCAGCAGG - Intergenic
1113293438 13:108931343-108931365 GTCTGTGAATGAAGGACAGAAGG + Intronic
1114410335 14:22494756-22494778 GTGAGGGAGTGAACACCAGATGG + Intergenic
1114716996 14:24837527-24837549 TTTTGGGAGTGATGGGCAGGAGG + Intronic
1115750021 14:36479997-36480019 ATTTGGGGGTGAAGGAAAGAAGG - Intronic
1117511215 14:56453328-56453350 GCTGTGAAGTGAAGGCCAGAGGG + Intergenic
1118698423 14:68409024-68409046 GTTGGGGACTGATGGCCAGTGGG + Intronic
1119074416 14:71621513-71621535 GTTTCTGAGTAAAGGCCAAATGG - Intronic
1120389184 14:83883742-83883764 GGTTGGGAGTGGAGGCTAGATGG - Intergenic
1122201111 14:100123246-100123268 GTTTGAGAGAGAAGGCGAGCAGG + Intronic
1122585568 14:102803800-102803822 GCTTGCAAGTGAAGGACAGATGG - Intronic
1123125103 14:105940721-105940743 CTTCGGGAGTGAAGGGCAGCAGG + Intergenic
1123489306 15:20767686-20767708 GTTTGGGTGTGATGGCAACACGG - Intergenic
1123545805 15:21336773-21336795 GTTTGGGTGTGATGGCAACACGG - Intergenic
1126335704 15:47584177-47584199 CTTTGGGAGTCCAGGGCAGATGG + Intronic
1128122280 15:65160225-65160247 GTTTGAAAGTGACAGCCAGATGG - Intronic
1128597143 15:68963330-68963352 CTTTGGGAGTCAAAGGCAGAAGG - Intronic
1128660071 15:69493636-69493658 GTCTGGCAGAGAAGGCCAGATGG - Intergenic
1131559514 15:93427270-93427292 GCTAGGGAGGGAAGGTCAGAAGG + Intergenic
1202954147 15_KI270727v1_random:64044-64066 GTTTGGGTGTGATGGCAACACGG - Intergenic
1133724914 16:8528417-8528439 GTTTGGGGGAGCAGGTCAGAAGG - Intergenic
1134839515 16:17390583-17390605 GTTTGGAGGTAAAGGCAAGATGG - Intronic
1134899324 16:17921731-17921753 GCTTGGGAGGGAAGCCCAGCAGG + Intergenic
1135160942 16:20095871-20095893 GAATGAGAGTGAAGGCGAGAAGG + Intergenic
1136045511 16:27611983-27612005 GTCTGGGAGCGGAGGCTAGAGGG + Intronic
1136407629 16:30057726-30057748 GTTTGGGGCTGAGGGGCAGAAGG + Intronic
1137478900 16:48834748-48834770 GTTTTGGGCTGAAGGGCAGAGGG + Intergenic
1137637401 16:49998859-49998881 CTTTGGGAGTCCAAGCCAGAAGG + Intergenic
1137853309 16:51767918-51767940 AGCTGGGAATGAAGGCCAGAAGG - Intergenic
1139086971 16:63598807-63598829 GTATGGGAGTGAAGGCAGTAGGG + Intergenic
1139384362 16:66555277-66555299 GATTGGTAGGGAAGGACAGAAGG + Intronic
1139677132 16:68531446-68531468 GTCTGGGAGTGTAGCCCAGTAGG + Intronic
1140995037 16:80250866-80250888 CTTTGGGAGTGCAGCCCAGTAGG - Intergenic
1141914829 16:87088156-87088178 GTTTGGGAATGCAGCCCAGTAGG + Intronic
1143831285 17:9653698-9653720 GTTTGGGGCTGAACGACAGAGGG + Intronic
1145868857 17:28257420-28257442 GTCTGGGATTGATGGCCTGATGG - Intergenic
1146229711 17:31096192-31096214 GTTGGGGAGTAAAGGGGAGAAGG + Intronic
1146883445 17:36456125-36456147 CTTTGGGAAGGAAGGACAGAAGG + Intergenic
1147426135 17:40346739-40346761 GTGTTGGAGTGAAGAGCAGACGG + Intronic
1147889287 17:43705712-43705734 GTTTGGGAGAGAGGGGCAGGAGG - Intergenic
1148159966 17:45444164-45444186 TGTGGGGAGGGAAGGCCAGACGG + Intronic
1148195112 17:45707597-45707619 GTTGGGCAGGGAAGGCCAAATGG + Intergenic
1148340671 17:46871763-46871785 GTCTGGGATTGATGGCCTGATGG + Intronic
1148856951 17:50584096-50584118 GTTTGGGAGAGGAGGCGAGAGGG + Intronic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1150391256 17:64791043-64791065 TGTGGGGAGGGAAGGCCAGACGG + Intergenic
1150410042 17:64935086-64935108 TGTGGGGAGGGAAGGCCAGATGG + Intergenic
1150805576 17:68316210-68316232 GTATTTGAGTGGAGGCCAGAAGG - Intronic
1151652181 17:75476902-75476924 GATTGGGAATGAGAGCCAGAAGG + Intronic
1152130145 17:78471693-78471715 GTGTGGCTGTGAAAGCCAGACGG - Intronic
1152146493 17:78571856-78571878 GTTTGGGATTGGTGGGCAGAAGG - Intronic
1152317946 17:79591609-79591631 GTTTGGGGCTGAATTCCAGAGGG - Intergenic
1153912636 18:9717629-9717651 CTCTGGGAGGGAAGGACAGAGGG + Intronic
1154941408 18:21116233-21116255 GTGTGGGAGGGAATGCCACAAGG - Intergenic
1155620788 18:27776927-27776949 GTTTGGGAGTGCAGTGGAGAAGG - Intergenic
1155948568 18:31883587-31883609 GTTGGGCAGTGATGGCCAAATGG - Intronic
1157234699 18:45953519-45953541 GTTTGGCAGTGAAGGGAAGCTGG - Intronic
1159105071 18:63995572-63995594 GATTGAGGGTGAAGGCCAGTAGG - Intronic
1159718194 18:71851199-71851221 GTTTTGGAGTGAAGTCTTGAGGG - Intergenic
1159796340 18:72848682-72848704 GGTGGGGAGTTAAGTCCAGAAGG - Intronic
1160038372 18:75321754-75321776 ATATTGGAGTAAAGGCCAGAAGG + Intergenic
1160275746 18:77433285-77433307 TTTTGGGTTTGCAGGCCAGATGG - Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160891229 19:1379751-1379773 GTTGGGGAGTGTGGGCCAGGTGG - Intergenic
1162283658 19:9720801-9720823 ATTAGGGACTGGAGGCCAGATGG - Intergenic
1163207485 19:15814281-15814303 GGGTGAGAGTTAAGGCCAGATGG - Intergenic
1164740542 19:30572451-30572473 GTTAGGGAGTGGAGGGTAGAGGG - Intronic
1165383962 19:35499765-35499787 GTTTGGAAGTGGAGGGCAGGAGG - Intronic
1165458797 19:35931830-35931852 GTTTGGGAATGGGGCCCAGAAGG + Intergenic
1166902748 19:46078550-46078572 GTTAGGGAGTGAAGGCCTTTAGG - Intergenic
925428242 2:3769172-3769194 GTTTGGGACTGCAGACCAGGTGG + Intronic
925592869 2:5527397-5527419 GGTTGGGATTGTCGGCCAGAAGG - Intergenic
926669169 2:15560313-15560335 GTTTGGTAGTGAAGGCCTCCCGG - Intronic
928657877 2:33472332-33472354 GAGTGGGAGTGAAGCCCTGAAGG + Intronic
929460633 2:42100401-42100423 GTTTAGGGGTGCAGGGCAGATGG + Intergenic
929982212 2:46692140-46692162 CTTTGGGAGTGAGGATCAGAAGG - Intergenic
931435181 2:62239764-62239786 GTGTGGAAGTGAACGCCACAGGG - Intergenic
932430654 2:71672013-71672035 CACTGGGAGGGAAGGCCAGAGGG + Intronic
933427318 2:82129533-82129555 GTCTGGGAGTGCAGCCCAGTAGG - Intergenic
934645794 2:96058776-96058798 TTTTGAGAGTGAAGGCCGGGTGG + Intergenic
934839198 2:97614865-97614887 TTTTGAGAGTGAAGGCCGGGTGG + Intergenic
935216811 2:100981404-100981426 GTTTGGGAGGGATGGCAGGAGGG - Intronic
936539871 2:113341332-113341354 AATTGGGAGTGAAGGCAGGAAGG - Intergenic
938035209 2:128029004-128029026 GTTTGAGAATGAAGGCATGAAGG - Intergenic
941517309 2:166494921-166494943 GTTTGGGAGTGAAGGCCAGAGGG + Intergenic
942210887 2:173668719-173668741 GGTTGGGAGGGGAGGGCAGAGGG + Intergenic
944891397 2:204120743-204120765 GTTTGGGAGTGAAGGAAAAAGGG - Intergenic
945060597 2:205905531-205905553 GTTGGGGAGAGAAGCACAGATGG - Intergenic
946773157 2:223110402-223110424 GTTTTTGAGTGAAGGACATAGGG - Intronic
946859387 2:223986097-223986119 GGTTGGGAGGGATGGACAGAGGG + Intronic
947923740 2:233902752-233902774 GTTTGAGAGTAAAGTCCAGAGGG + Intergenic
948916128 2:241035848-241035870 GGTTGGGAGTGAGGGGTAGAGGG + Intronic
1168773129 20:428702-428724 GGATGGGAGTGACAGCCAGAAGG - Intronic
1169235625 20:3927719-3927741 GCCTGGGAGGGAAGGGCAGATGG + Intronic
1173020983 20:39268227-39268249 GATTGGGAGAGAAGGATAGAGGG + Intergenic
1173429922 20:42978579-42978601 GTCTGGGAATGCAGGCCAGTAGG - Intronic
1173614676 20:44394984-44395006 GCTTGGGGCTGAAGGCCAGTGGG - Intronic
1174292860 20:49521340-49521362 TTTTGGGAGTGGAGCCAAGAGGG - Intronic
1174887990 20:54356986-54357008 GTTTTGGAAAGCAGGCCAGATGG + Intergenic
1175826109 20:61937540-61937562 TCTTGGGAGTCAAGGCCAGCTGG + Exonic
1177029413 21:15963798-15963820 TTCTGGGAGTGAGGTCCAGATGG - Intergenic
1177534374 21:22405146-22405168 GATAGTCAGTGAAGGCCAGATGG + Intergenic
1178720283 21:35002669-35002691 GTTTGGGAGGGCAAGGCAGATGG - Intronic
1179199355 21:39201343-39201365 GTTTGGCAGTGATGTGCAGAGGG - Intronic
1180148449 21:45935082-45935104 GTTTGGGACTGAAGCTCACAGGG + Intronic
1180165152 21:46021876-46021898 GGTTGGGACTGAAGGCCACCTGG - Intergenic
1181030290 22:20146215-20146237 GTTTGGCAGGGAGGGCCTGAGGG - Intronic
1181513004 22:23397158-23397180 GTTTGGCAGGGAGGGCCTGAGGG + Intergenic
1181803671 22:25362548-25362570 TTTTGGGAGTGGAGCCTAGAGGG - Exonic
1182072855 22:27475747-27475769 GTGAGGGAGTGAAGCCCGGAAGG + Intergenic
1182492863 22:30685187-30685209 ATTTTGGAATGAAGACCAGATGG + Intergenic
1183537889 22:38413673-38413695 GGAGGGGAGGGAAGGCCAGAGGG - Intergenic
1184104966 22:42362214-42362236 TTTTGGGAGAGAAGTCCAGGCGG + Intergenic
1184409859 22:44320199-44320221 GTGTGGGAGAGAGGGACAGAAGG + Intergenic
1185264733 22:49894980-49895002 ATGTGGGAGTGAAGCCCAGGAGG + Intergenic
949684189 3:6549376-6549398 GTGTGGCAGAGAAGGACAGAAGG + Intergenic
949730587 3:7107958-7107980 GTTTGAGAGTAAAAGCAAGATGG + Intronic
954183435 3:48899027-48899049 GTTTGGGAGTGTGGGCCAGCGGG + Intergenic
954436296 3:50498188-50498210 GTTTGGGAGTCAAGGCAGGTGGG - Intronic
954789477 3:53120843-53120865 GGTTGGGAGTGGAGAGCAGAGGG - Intronic
954930758 3:54279343-54279365 GTGTGGGAGTGAGGACCAAACGG + Intronic
955935373 3:64097955-64097977 ATTTGGGATTGAGGGACAGAAGG - Exonic
956517265 3:70062997-70063019 GTTTTGTAGTGAAGGGCAGAAGG - Intergenic
958156508 3:89762067-89762089 GTCTGGGGGTGAAGCCGAGAGGG + Intergenic
959695211 3:109241836-109241858 GTTTGGTACTAAAGTCCAGAGGG - Intergenic
960065932 3:113372575-113372597 GTTGGGGAGTGGGGGGCAGAGGG + Intronic
960110657 3:113841529-113841551 CTTTGGGAGGGAAAGCCAGGTGG - Intronic
960603161 3:119478153-119478175 ATTTGGGGGTGAAGGCAGGAAGG + Intronic
961523539 3:127482432-127482454 TTTTGGCAGTGCAGGCCATATGG - Intergenic
961926204 3:130483620-130483642 GTTGGGGAGGGAGGCCCAGAAGG + Intronic
961934332 3:130567284-130567306 ATTTGCGAGTGAAGGTCAGTAGG - Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962456249 3:135568102-135568124 GTTTGGGAATCCAGGGCAGAGGG - Intergenic
963547016 3:146672176-146672198 GTCTGGGAGTGAAGCAAAGAGGG + Intergenic
964962004 3:162438552-162438574 GTTTTAGAGTGAACTCCAGAGGG + Intergenic
965895417 3:173570085-173570107 TCTTGGGAGTGGGGGCCAGAAGG + Intronic
966034911 3:175399764-175399786 GTCTGGGAATGCAGCCCAGAAGG + Intronic
966304063 3:178511099-178511121 ATTTGAGAGTAAAGTCCAGATGG - Intronic
969622810 4:8287138-8287160 GTTTGGGCGTGGAGGCCAGGGGG + Intronic
969909356 4:10429030-10429052 GTTTGGGTTTGAAGATCAGAAGG - Intergenic
971418590 4:26455587-26455609 GTCTGGGAGTGATGGGGAGAGGG + Intergenic
972592043 4:40497152-40497174 ACTTGGGAGTTAAGGCCAGCTGG - Intronic
972656580 4:41069186-41069208 ATTTGAGAGTAAAGGCAAGAAGG + Intronic
977630943 4:99242368-99242390 GTTGGGGAGTGAAGGGCAAGGGG - Intergenic
981471164 4:145137293-145137315 GTATGGGAGTGAAGGTAAGGGGG + Exonic
983467115 4:168108303-168108325 GTCTGGGAATGCAGGCCAGTAGG + Intronic
985377483 4:189356156-189356178 GCTTGGGAGTGAGGGGAAGATGG + Intergenic
990021927 5:51138216-51138238 GTGTGAGAGTCAAAGCCAGACGG + Intergenic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991911454 5:71566577-71566599 TTTTGGGTTTGCAGGCCAGATGG + Exonic
992455396 5:76911369-76911391 GTTTGGGAGAGCAGGCTATAGGG - Intronic
994067062 5:95555213-95555235 GCTAGGGAGAGAACGCCAGAGGG + Exonic
994227958 5:97275923-97275945 GGTTGGGAGTTAAGGAAAGAAGG - Intergenic
995102699 5:108333686-108333708 GTATGTGACTGAAGTCCAGAAGG - Intronic
996965213 5:129299911-129299933 GTTGGGGGGTGAAGGGCAAAGGG - Intergenic
998021114 5:138771179-138771201 ATTTGTGAGTGAAGGCTAAATGG + Intronic
998893151 5:146768315-146768337 CTTTGGGAGTCCAGGGCAGATGG - Intronic
999335679 5:150714359-150714381 TTTTTGGAGTGATGGCCACAGGG - Intronic
999460921 5:151757318-151757340 CTTGGGGAGTGAAGGCCACCAGG - Intronic
999620803 5:153471273-153471295 GTTGGGGGGTGGAGGGCAGAAGG - Intergenic
999904491 5:156124748-156124770 GTTGGGGAGGGAGGGACAGATGG + Intronic
1000843692 5:166252921-166252943 GTGTGGTAGTGAATGCCACAAGG + Intergenic
1001223984 5:169928113-169928135 GTTTGGCTGGGAAGGCCTGAAGG - Intronic
1001510217 5:172315434-172315456 GTCTGGGAATGAAGCCCAGCAGG - Intergenic
1002160233 5:177310598-177310620 GCAGGGGAGGGAAGGCCAGAGGG + Intronic
1002434564 5:179222707-179222729 GGTTGGGAGCACAGGCCAGAGGG - Intronic
1002687938 5:181029207-181029229 GTTTGGGAGAGAGAGGCAGATGG + Intergenic
1003578821 6:7321014-7321036 GGATGGGAATGGAGGCCAGACGG + Intronic
1005001124 6:21243004-21243026 GTTTAGGATTGATGACCAGATGG - Intergenic
1005960123 6:30687983-30688005 GTTTGGGAAAGAAAGCCAGAGGG - Intergenic
1006305155 6:33214162-33214184 GTTTCAGAGTGAAGGCAGGACGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009953440 6:70423046-70423068 GTATTTGAGTCAAGGCCAGAGGG + Intronic
1013813078 6:114066409-114066431 GTTTGGGAGTCCAAGGCAGATGG + Intronic
1015554993 6:134451861-134451883 TTTTGTAAGTGAAGTCCAGAAGG - Intergenic
1016725220 6:147357409-147357431 CTTTGGGAGATAAGGCCAGGAGG + Intronic
1017941873 6:159060509-159060531 ATTTGGGAGTGAGGGGCAGGGGG - Intergenic
1019775387 7:2909460-2909482 GCTGGGGAGTGAGGGGCAGAGGG - Intronic
1020350772 7:7216151-7216173 GTTTGAGAGTGCACTCCAGAGGG + Intronic
1023518397 7:41026459-41026481 TTTTGGGAGTCCAGGGCAGAAGG + Intergenic
1024064179 7:45718967-45718989 GTTGGGGAATGAATGCCACACGG + Exonic
1024081376 7:45858828-45858850 GTCTGGGAGTGCAGCCCAGTAGG + Intergenic
1024123109 7:46265071-46265093 GTTTAAAAGTGAGGGCCAGATGG + Intergenic
1024435443 7:49348272-49348294 ATTTGAGAGTGAAGGGGAGAAGG - Intergenic
1027818448 7:83010624-83010646 GTTTGAGAGGCAAGGCAAGATGG - Intronic
1029195644 7:98803533-98803555 GTTTGGCAATGTAGGCAAGAAGG - Intergenic
1032109069 7:129059920-129059942 GTGTGGGACTGAAGCCCAGGGGG + Intergenic
1032180281 7:129670175-129670197 GTCTGGGGGTGAGGGACAGATGG + Intronic
1032494149 7:132348418-132348440 GTTTGTGAGTGAATGCATGAAGG + Intronic
1032616093 7:133472675-133472697 GTTTGGGACTCAAAGACAGAAGG + Intronic
1035349835 7:158238180-158238202 GGCTGGGAGGAAAGGCCAGAGGG + Intronic
1035969079 8:4227754-4227776 GTTTGGGATTGAATGCAGGATGG - Intronic
1037123035 8:15312996-15313018 GTAAGGGAGTGGTGGCCAGAAGG - Intergenic
1038268294 8:26052879-26052901 GTTGAGGGGTGAGGGCCAGAAGG - Intergenic
1038548369 8:28443655-28443677 GTCTGGGAGTGAAGCCCAGTAGG - Intronic
1039829338 8:41200568-41200590 GGATGGGGGTGAGGGCCAGAAGG - Intergenic
1040101643 8:43511705-43511727 GTTCGGGAGAGATGGCCAGTGGG + Intergenic
1040989183 8:53330798-53330820 GATTGGGAGTGAAGGCTAATAGG - Intergenic
1041095757 8:54347882-54347904 GTTAGGGAGAGCAGGCCATAGGG - Intergenic
1041925430 8:63231073-63231095 TTTTGGTAGTGATGGCCAGAAGG - Intergenic
1042084218 8:65089726-65089748 ATTTGGGACTCAAGGCCTGATGG - Intergenic
1044783029 8:95763113-95763135 ATTTGGGAGTGAAGAACAGTTGG - Intergenic
1045481526 8:102596743-102596765 TCTTGGGACTGAAGGCCAGTGGG - Intergenic
1045484890 8:102623139-102623161 GTTTGGGGGAGAAGGGTAGATGG - Intergenic
1046502374 8:115095499-115095521 GTTTGGGAATGCAGCCCAGTAGG - Intergenic
1047230969 8:122997467-122997489 ATTTGGGATAGAAGGCAAGAAGG - Intergenic
1049305309 8:141899703-141899725 GTCTGGGAGACAAGGCCAGGTGG - Intergenic
1052454516 9:28678228-28678250 GAGTGGGAGAGCAGGCCAGAAGG - Intergenic
1053303976 9:36970861-36970883 GTGTGGGAGTGAAGGGCCCAGGG - Intronic
1055294646 9:74821685-74821707 GTTTGTGTGTGAAGGCCAGGAGG + Exonic
1055970128 9:81903359-81903381 GTTTGAGAGTGTTGGCAAGAGGG + Intergenic
1056173639 9:84012885-84012907 GATTGGGGGTGAAGGGCAGATGG + Intergenic
1056273963 9:84974852-84974874 GTTTGGGAGTTAAGGGGAGCAGG + Intronic
1056443147 9:86640201-86640223 GCATGGGAGGGAAGGCAAGAAGG - Intergenic
1057825903 9:98371905-98371927 GAGGGGAAGTGAAGGCCAGAGGG - Intronic
1059055055 9:110970679-110970701 GTTTGTGAGAGAAGGAGAGAAGG - Intronic
1059345276 9:113624093-113624115 GTTTGGGAATTAGGGCCAAATGG + Intergenic
1059935830 9:119309762-119309784 AGTTAGGAGTGAAGGACAGAGGG - Intronic
1060787309 9:126460724-126460746 GTTCCAGAGTGATGGCCAGATGG + Intronic
1061533217 9:131230810-131230832 CTTTGGGGGAGAAGGCAAGAGGG - Intronic
1061826447 9:133261108-133261130 GTTGGGGACTGGAGGTCAGAAGG + Intronic
1062480648 9:136749295-136749317 GTGTGGGAGTGAATCCCAGAGGG - Intergenic
1185868138 X:3640701-3640723 GTCTGGGAGTGCAGCCCAGTAGG - Intronic
1185884663 X:3771809-3771831 GTCTGGGAATGAAGCCCAGTAGG + Intergenic
1187277258 X:17827104-17827126 ATTGGGGAGCTAAGGCCAGATGG + Intronic
1191850496 X:65582470-65582492 GTTTGGGGGTGAGGGTGAGAAGG + Intergenic
1192268728 X:69558337-69558359 CTTTGGGTCTGAAGGCAAGATGG + Intergenic
1195735398 X:108007733-108007755 GTTTGGCTGTGAAGGGGAGAAGG + Intergenic
1196661114 X:118269784-118269806 GTTTGGGAGGGAAAGGAAGAGGG + Intergenic
1197590512 X:128403871-128403893 GTTGGAGAATGAAGGCAAGAGGG + Intergenic
1197690196 X:129491497-129491519 ATTTGGGAGAGAAGGCAAAAAGG - Intronic
1199819097 X:151427063-151427085 TTTTGGGAGTGAAGGAAAGGAGG + Intergenic
1200796102 Y:7342646-7342668 GTCTGGGAGTGCAGCCCAGTAGG + Intergenic
1200954777 Y:8931784-8931806 GTTTGGGAGTGGGGGCCTGGGGG + Intergenic