ID: 941524623

View in Genome Browser
Species Human (GRCh38)
Location 2:166591897-166591919
Sequence CATATTAGACATATCTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941524623_941524624 -4 Left 941524623 2:166591897-166591919 CCTTGTCAGATATGTCTAATATG No data
Right 941524624 2:166591916-166591938 TATGTCTGTAATCTCAGTGTTGG No data
941524623_941524625 6 Left 941524623 2:166591897-166591919 CCTTGTCAGATATGTCTAATATG No data
Right 941524625 2:166591926-166591948 ATCTCAGTGTTGGTGTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941524623 Original CRISPR CATATTAGACATATCTGACA AGG (reversed) Intergenic
No off target data available for this crispr