ID: 941527001

View in Genome Browser
Species Human (GRCh38)
Location 2:166618487-166618509
Sequence ACTAGACAGTGCCCCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941527001_941527006 -5 Left 941527001 2:166618487-166618509 CCCCCACTGGGGCACTGTCTAGT No data
Right 941527006 2:166618505-166618527 CTAGTGGAGCTGTGAGAAGAAGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941527001 Original CRISPR ACTAGACAGTGCCCCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr