ID: 941527006

View in Genome Browser
Species Human (GRCh38)
Location 2:166618505-166618527
Sequence CTAGTGGAGCTGTGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6609
Summary {0: 1665, 1: 2050, 2: 1368, 3: 825, 4: 701}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941526997_941527006 7 Left 941526997 2:166618475-166618497 CCCACACAGAGTCCCCCACTGGG No data
Right 941527006 2:166618505-166618527 CTAGTGGAGCTGTGAGAAGAAGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
941527005_941527006 -8 Left 941527005 2:166618490-166618512 CCACTGGGGCACTGTCTAGTGGA 0: 32
1: 771
2: 1207
3: 1064
4: 948
Right 941527006 2:166618505-166618527 CTAGTGGAGCTGTGAGAAGAAGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
941527003_941527006 -7 Left 941527003 2:166618489-166618511 CCCACTGGGGCACTGTCTAGTGG 0: 51
1: 1065
2: 1684
3: 1621
4: 1291
Right 941527006 2:166618505-166618527 CTAGTGGAGCTGTGAGAAGAAGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
941527002_941527006 -6 Left 941527002 2:166618488-166618510 CCCCACTGGGGCACTGTCTAGTG 0: 32
1: 737
2: 1461
3: 1607
4: 1371
Right 941527006 2:166618505-166618527 CTAGTGGAGCTGTGAGAAGAAGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
941527001_941527006 -5 Left 941527001 2:166618487-166618509 CCCCCACTGGGGCACTGTCTAGT No data
Right 941527006 2:166618505-166618527 CTAGTGGAGCTGTGAGAAGAAGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
941526999_941527006 6 Left 941526999 2:166618476-166618498 CCACACAGAGTCCCCCACTGGGG No data
Right 941527006 2:166618505-166618527 CTAGTGGAGCTGTGAGAAGAAGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941527006 Original CRISPR CTAGTGGAGCTGTGAGAAGA AGG Intergenic
Too many off-targets to display for this crispr