ID: 941528055

View in Genome Browser
Species Human (GRCh38)
Location 2:166630530-166630552
Sequence TAGAATAGTATAGCCAGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941528055_941528061 0 Left 941528055 2:166630530-166630552 CCCCCACTGGCTATACTATTCTA No data
Right 941528061 2:166630553-166630575 GGGTAAAAGTTTGTTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941528055 Original CRISPR TAGAATAGTATAGCCAGTGG GGG (reversed) Intergenic
No off target data available for this crispr