ID: 941528352

View in Genome Browser
Species Human (GRCh38)
Location 2:166633025-166633047
Sequence AGGGAGAGCCCAGCAATTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941528352_941528358 22 Left 941528352 2:166633025-166633047 CCCAGAATTGCTGGGCTCTCCCT No data
Right 941528358 2:166633070-166633092 TTCCACATGTAGCTACTATTGGG No data
941528352_941528363 30 Left 941528352 2:166633025-166633047 CCCAGAATTGCTGGGCTCTCCCT No data
Right 941528363 2:166633078-166633100 GTAGCTACTATTGGGGGATTGGG No data
941528352_941528357 21 Left 941528352 2:166633025-166633047 CCCAGAATTGCTGGGCTCTCCCT No data
Right 941528357 2:166633069-166633091 CTTCCACATGTAGCTACTATTGG No data
941528352_941528359 23 Left 941528352 2:166633025-166633047 CCCAGAATTGCTGGGCTCTCCCT No data
Right 941528359 2:166633071-166633093 TCCACATGTAGCTACTATTGGGG No data
941528352_941528361 24 Left 941528352 2:166633025-166633047 CCCAGAATTGCTGGGCTCTCCCT No data
Right 941528361 2:166633072-166633094 CCACATGTAGCTACTATTGGGGG No data
941528352_941528362 29 Left 941528352 2:166633025-166633047 CCCAGAATTGCTGGGCTCTCCCT No data
Right 941528362 2:166633077-166633099 TGTAGCTACTATTGGGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941528352 Original CRISPR AGGGAGAGCCCAGCAATTCT GGG (reversed) Intergenic
No off target data available for this crispr