ID: 941533043

View in Genome Browser
Species Human (GRCh38)
Location 2:166692961-166692983
Sequence GTTGCACGCACCTGCGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941533031_941533043 17 Left 941533031 2:166692921-166692943 CCCTCTGCCCCCCTGGATATTAC No data
Right 941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG No data
941533030_941533043 18 Left 941533030 2:166692920-166692942 CCCCTCTGCCCCCCTGGATATTA No data
Right 941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG No data
941533032_941533043 16 Left 941533032 2:166692922-166692944 CCTCTGCCCCCCTGGATATTACG No data
Right 941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG No data
941533036_941533043 7 Left 941533036 2:166692931-166692953 CCCTGGATATTACGATCAACATC No data
Right 941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG No data
941533033_941533043 10 Left 941533033 2:166692928-166692950 CCCCCCTGGATATTACGATCAAC No data
Right 941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG No data
941533034_941533043 9 Left 941533034 2:166692929-166692951 CCCCCTGGATATTACGATCAACA No data
Right 941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG No data
941533029_941533043 19 Left 941533029 2:166692919-166692941 CCCCCTCTGCCCCCCTGGATATT No data
Right 941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG No data
941533035_941533043 8 Left 941533035 2:166692930-166692952 CCCCTGGATATTACGATCAACAT No data
Right 941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG No data
941533037_941533043 6 Left 941533037 2:166692932-166692954 CCTGGATATTACGATCAACATCG No data
Right 941533043 2:166692961-166692983 GTTGCACGCACCTGCGATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941533043 Original CRISPR GTTGCACGCACCTGCGATGT GGG Intergenic
No off target data available for this crispr