ID: 941541716

View in Genome Browser
Species Human (GRCh38)
Location 2:166794241-166794263
Sequence GGTACCAGTGGAGCATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941541707_941541716 22 Left 941541707 2:166794196-166794218 CCAGAGGTGTGCAAGACACTGAG No data
Right 941541716 2:166794241-166794263 GGTACCAGTGGAGCATGTCCAGG No data
941541710_941541716 -4 Left 941541710 2:166794222-166794244 CCACCCTAGTAGACCCTCTGGTA No data
Right 941541716 2:166794241-166794263 GGTACCAGTGGAGCATGTCCAGG No data
941541706_941541716 26 Left 941541706 2:166794192-166794214 CCTGCCAGAGGTGTGCAAGACAC No data
Right 941541716 2:166794241-166794263 GGTACCAGTGGAGCATGTCCAGG No data
941541711_941541716 -7 Left 941541711 2:166794225-166794247 CCCTAGTAGACCCTCTGGTACCA No data
Right 941541716 2:166794241-166794263 GGTACCAGTGGAGCATGTCCAGG No data
941541712_941541716 -8 Left 941541712 2:166794226-166794248 CCTAGTAGACCCTCTGGTACCAG No data
Right 941541716 2:166794241-166794263 GGTACCAGTGGAGCATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941541716 Original CRISPR GGTACCAGTGGAGCATGTCC AGG Intergenic
No off target data available for this crispr