ID: 941548650

View in Genome Browser
Species Human (GRCh38)
Location 2:166886562-166886584
Sequence CTGTTGGCACATTTGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941548650_941548655 1 Left 941548650 2:166886562-166886584 CCAAACCCCAAATGTGCCAACAG 0: 1
1: 0
2: 1
3: 25
4: 209
Right 941548655 2:166886586-166886608 AGTCCCATCGCAACATTATGTGG 0: 1
1: 0
2: 0
3: 9
4: 35
941548650_941548656 2 Left 941548650 2:166886562-166886584 CCAAACCCCAAATGTGCCAACAG 0: 1
1: 0
2: 1
3: 25
4: 209
Right 941548656 2:166886587-166886609 GTCCCATCGCAACATTATGTGGG 0: 1
1: 0
2: 0
3: 2
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941548650 Original CRISPR CTGTTGGCACATTTGGGGTT TGG (reversed) Intergenic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900438778 1:2643264-2643286 CTGTTGGCTCATTTCCGGGTGGG + Intronic
901339159 1:8479635-8479657 CTGTTTGCACATTTTGGCTGTGG - Intronic
903003654 1:20284112-20284134 CTGCTGGCCCCTTTGGGCTTTGG - Intergenic
905648083 1:39638639-39638661 TTGGTGGCAGATTTGGGGCTGGG + Intronic
905841759 1:41186616-41186638 ATGTAGTCACATTGGGGGTTAGG - Intronic
906370162 1:45247215-45247237 GCGTTGGCAGATTTGGTGTTTGG - Intronic
906797214 1:48707845-48707867 CTGTTGTCTCATTTGAGTTTGGG + Intronic
911509784 1:98797316-98797338 TTTTTGACACACTTGGGGTTGGG - Intergenic
912122805 1:106493296-106493318 CTATTGGCCCATTAGGGTTTTGG + Intergenic
913424600 1:118713381-118713403 ATGGTGCCACAGTTGGGGTTTGG - Intergenic
913446526 1:118956117-118956139 GTGGTGGAAGATTTGGGGTTTGG - Intronic
915062592 1:153198566-153198588 CTGATAGCACATTTGGTGTGAGG + Intergenic
915700121 1:157784232-157784254 CTGGTGGATCATTTGGGGTCAGG - Intergenic
917015530 1:170527718-170527740 GTGTTGGCAGATTTGGTGTCTGG + Intergenic
917145477 1:171885844-171885866 CTGTTTGCACAGTGAGGGTTAGG + Intronic
917992244 1:180393123-180393145 TTCTTGCCACATTTGGGATTAGG - Intronic
921130759 1:212217588-212217610 CTATTGTCACATTAGGGGGTAGG + Intergenic
921581672 1:216902863-216902885 CTGTTGACACATTTGGCCTGTGG + Intronic
1065976945 10:30849931-30849953 CTGAGGACACATTTGGGTTTGGG + Exonic
1066270845 10:33821191-33821213 GTGTTGGGACTTTTGGAGTTTGG + Intergenic
1067530336 10:47066520-47066542 CAGGTGGATCATTTGGGGTTGGG + Intergenic
1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG + Intronic
1068825778 10:61437258-61437280 ATATTGTCACATTTGGGGTTAGG + Intronic
1069985213 10:72278290-72278312 CTTTTAGGACATTTGGTGTTGGG + Intergenic
1071965229 10:90845172-90845194 CTGATGGCACTTTTTGGGATGGG + Intronic
1073610836 10:104941131-104941153 CTTTTGGCACATCTTGGTTTTGG + Intronic
1074219582 10:111423326-111423348 CTGTAGGCACTTTTAGTGTTTGG - Intergenic
1074360655 10:112822082-112822104 CTGGGGGCAGATTTTGGGTTTGG + Intergenic
1075042973 10:119123315-119123337 AGGTTAGCACATTTGGGGCTTGG + Intronic
1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG + Intronic
1077610588 11:3641441-3641463 CTGTACCCACATTTGGGGTAGGG + Intronic
1079626567 11:22624230-22624252 CTGTTGGCCTATCTGGAGTTTGG - Exonic
1080814501 11:35741051-35741073 CTGATTGCAAATTTGTGGTTTGG + Intronic
1081573606 11:44306235-44306257 CTTTTAGCACATTTGGGGAAAGG + Intronic
1082126740 11:48440906-48440928 CTGTTGGGGGATTGGGGGTTAGG + Intergenic
1090989199 11:131801018-131801040 ATGTTGGGGCATTTGGGGCTGGG + Intronic
1091166220 11:133478513-133478535 CAGGTGGTATATTTGGGGTTGGG - Intronic
1091972255 12:4797249-4797271 CTGCTGGGACGTTTGGGGATTGG - Intronic
1092395454 12:8121935-8121957 GTGTTGGCCCAGTTGGGGTTGGG + Intergenic
1092500499 12:9041604-9041626 CTCTTGGCACATTTGCACTTGGG + Intergenic
1092579089 12:9819970-9819992 CTGTTGTCACTTTTGGGCGTTGG + Intergenic
1093619523 12:21272058-21272080 CTTTTCAAACATTTGGGGTTTGG + Intronic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1094820751 12:34222359-34222381 CTGTTGGCAATTTTGGGTTTGGG + Intergenic
1096216001 12:49797601-49797623 TTCCTGGCACACTTGGGGTTGGG + Intronic
1097638513 12:62150673-62150695 CTGTTGGATCATTTGAGGTCAGG + Intronic
1098202427 12:68069734-68069756 ATGTGGGCACCTTTGGGTTTAGG + Intergenic
1100704999 12:97190955-97190977 TTGTTTGGACATTTTGGGTTAGG - Intergenic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1103124515 12:118409845-118409867 CTTTTGTCCCATTTGGGCTTTGG + Intronic
1103643412 12:122371366-122371388 AATTTGGCACCTTTGGGGTTAGG + Intronic
1103886418 12:124205083-124205105 GTGCTGGCAGATTTGGTGTTTGG - Intronic
1103929991 12:124445043-124445065 CTGCTGCCTCATTTGGGGGTCGG - Intronic
1104283928 12:127405667-127405689 CTCTTGGCCCATGTGTGGTTGGG + Intergenic
1104707357 12:130957133-130957155 GTGTTGGCACATGTGGGTGTGGG - Intronic
1104734994 12:131131163-131131185 CTGTTGGGACCTATGGGGCTGGG - Intronic
1105022348 12:132825435-132825457 GTGTTGGCACTTTAGGAGTTGGG - Intronic
1106900070 13:34346403-34346425 GTGTTGGGATATTTGTGGTTTGG - Intergenic
1107967856 13:45613705-45613727 CTGGTTCCACATTTGGAGTTTGG + Intronic
1110925319 13:81143401-81143423 GTGCTGGCAGATTTGGTGTTTGG + Intergenic
1113237983 13:108302784-108302806 CTGTTGCCACATTTGGGCCAAGG + Intronic
1114838366 14:26232089-26232111 GTGCTGGCAAATTTGGTGTTTGG - Intergenic
1119028644 14:71174303-71174325 GTGTAGGCAGTTTTGGGGTTTGG + Intergenic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119516097 14:75249686-75249708 CGGCAGGCACATTTGTGGTTTGG - Intronic
1123412524 15:20072408-20072430 GTGTTTACACATATGGGGTTTGG + Intergenic
1123521866 15:21079521-21079543 GTGTTTACACATATGGGGTTTGG + Intergenic
1124922620 15:34041085-34041107 ATGTTGGCAAATTTAGGGCTGGG + Intronic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1128405460 15:67332989-67333011 CTGCTGGCAGATTTGGTGTCTGG + Intronic
1129429243 15:75486463-75486485 GTGCTGGCAGATTTGGGGTCTGG - Intronic
1129511923 15:76130308-76130330 CGGTTGGCTCACTTGAGGTTGGG + Intronic
1129942078 15:79506939-79506961 GTGCTGGCAAATTTGGGTTTTGG + Intergenic
1131570123 15:93526108-93526130 CTGGTGGTACATTTGAGATTTGG + Intergenic
1133661419 16:7921594-7921616 CTGTTGGTACCTTTGTGGTGAGG - Intergenic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1135227514 16:20674612-20674634 CTGGTGGCCCATATGGGGATTGG + Intronic
1137953205 16:52803161-52803183 CTGTGATCACCTTTGGGGTTTGG - Intergenic
1138113761 16:54344349-54344371 CAGGTGGAACATTTGGGGTCAGG - Intergenic
1139076200 16:63451927-63451949 ATTTTGAAACATTTGGGGTTTGG - Intergenic
1140476354 16:75241173-75241195 GTGTTTACACATATGGGGTTTGG + Intronic
1142183388 16:88682514-88682536 CTGTTGGGAGATTTTGGCTTTGG - Intronic
1142279056 16:89138237-89138259 CTGATGGCACATTTGAGGTCAGG + Intronic
1142474140 17:179968-179990 CTGGTGGCACATTTGATGCTTGG + Intronic
1142739105 17:1920244-1920266 CCGTTGGCCCAAGTGGGGTTGGG + Intergenic
1144329602 17:14212140-14212162 CTCTTTGGACGTTTGGGGTTGGG - Intergenic
1146126908 17:30237448-30237470 CAGTAGGGACATTAGGGGTTAGG + Intergenic
1148636840 17:49155373-49155395 CTGTTGGATCATTTGAGGTCAGG + Intronic
1148759164 17:49990594-49990616 CTCTTTGGAGATTTGGGGTTTGG + Exonic
1149547509 17:57514917-57514939 CAGTTGGCCCATATGTGGTTTGG - Intronic
1149950019 17:60975963-60975985 TTGTTTCCACATTTGGGCTTAGG + Intronic
1150368192 17:64610601-64610623 CTGTTGGCGGGTTGGGGGTTAGG + Intronic
1150371117 17:64638936-64638958 CTGTGGGCACTTTTGGGGTCTGG - Intronic
1151512913 17:74572456-74572478 ATGTTGGTAGATTTGGTGTTTGG - Intergenic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1155203655 18:23538542-23538564 CCTTTGCCACACTTGGGGTTAGG + Exonic
1155307099 18:24489127-24489149 CTGTTGCTTCTTTTGGGGTTGGG - Intergenic
1155565498 18:27129618-27129640 CTGATGGAACATTTGAGGTCAGG - Intronic
1158400841 18:57120234-57120256 CTGGTGGATCATTTGGGGTCAGG - Intergenic
1159379121 18:67633479-67633501 TTGCAGGCACATTTGTGGTTTGG - Intergenic
1159611950 18:70535569-70535591 CTATAGTCACATTAGGGGTTAGG + Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160781332 19:879011-879033 CTGCTGGGACATGTGGGGCTGGG - Intronic
1163492274 19:17623783-17623805 CTGTGGGCACATTAGGGAGTGGG - Intronic
1163519156 19:17781612-17781634 CTGTTGGCAGAGGTGTGGTTGGG + Intronic
1164812475 19:31168640-31168662 CTTTTGGCACATCTGAGGTGGGG + Intergenic
1165022268 19:32934716-32934738 CTCTTGGCACATTTCAGGCTTGG - Intronic
926226737 2:10972109-10972131 CTGATGGCACATTTGGCTATAGG + Intergenic
926681573 2:15667846-15667868 ATGTTAGCACAGTTGAGGTTTGG + Intergenic
927313615 2:21657022-21657044 GTGTGGGCACATCTTGGGTTGGG + Intergenic
929144880 2:38697926-38697948 CTGTTGGCAATTTTGGGTTTTGG + Intronic
929859059 2:45660126-45660148 CTGTTGGTAGATATGGGGTTTGG + Intronic
930180239 2:48348834-48348856 CTTGTGCCACATTTGAGGTTGGG + Intronic
931079682 2:58754650-58754672 CTATTTGTACATTTGAGGTTTGG + Intergenic
932296890 2:70632176-70632198 CTGTTGGCACATTTGTGTCATGG + Intronic
932870825 2:75395992-75396014 ATGTTGCCACAATTGGGGATGGG + Intergenic
935206167 2:100897903-100897925 CAGTTGGCACATTTGTGCTTTGG + Intronic
936675991 2:114714637-114714659 CTCATGGCATATTTAGGGTTTGG + Intronic
937332932 2:121043379-121043401 ATATTGCCACATTGGGGGTTAGG - Intergenic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
942562564 2:177235894-177235916 CTATTGACACATTTTTGGTTAGG - Intronic
943014984 2:182499449-182499471 CTGGTGGCTCATTTGAGGTCAGG - Intronic
946718700 2:222581017-222581039 CTGTTGGCTCATGTGGGCTGTGG - Intronic
947944452 2:234089690-234089712 CATGTGACACATTTGGGGTTGGG + Intergenic
948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG + Intronic
1168837319 20:885845-885867 CTCTTGCCACACATGGGGTTAGG - Intronic
1170718075 20:18849177-18849199 CTGTTAGCCCATTTGGGGACTGG + Intergenic
1170831990 20:19850735-19850757 CTGGTGGATCATTTGGGGTCAGG + Intergenic
1173850722 20:46216233-46216255 CTGCTGGCACAGCGGGGGTTGGG - Intronic
1174156554 20:48519371-48519393 CTGCTGGCTCCTGTGGGGTTGGG - Intergenic
1174253869 20:49239474-49239496 ATGTTTCCACATTTGGGGTGTGG + Intronic
1175559885 20:59914436-59914458 CTGTTGGCACACTTGTTATTTGG - Intronic
1176871614 21:14087115-14087137 CTGTTGGCAATTTTGGTTTTTGG + Intergenic
1177794808 21:25763156-25763178 CTCTTGGCATGTTTGGGTTTGGG + Intronic
1177923548 21:27184877-27184899 ATGCTGGCAGATTTGGTGTTTGG + Intergenic
1177937073 21:27362245-27362267 CTGCTGAAACACTTGGGGTTAGG - Intergenic
1179562151 21:42222398-42222420 CTGTTGGCTTATTTGGGGATGGG + Intronic
1181624334 22:24113190-24113212 CTGTTGTCAAATGTGGAGTTAGG - Intronic
1181773825 22:25145458-25145480 GTGTAGGAACATTTGGGATTGGG + Intronic
1183045469 22:35216111-35216133 CTGTGGGCAGATTTGGTGTTTGG + Intergenic
1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG + Exonic
1184513340 22:44945703-44945725 CTGTTGGCAGAATTGGGGGGGGG + Intronic
950323583 3:12082458-12082480 CTGTTCGCAAATTTGGCCTTTGG - Intronic
951291038 3:20872795-20872817 ATGTTGCCACTCTTGGGGTTGGG - Intergenic
951337397 3:21441384-21441406 CTGTTGGCAGCTCTGGCGTTGGG - Intronic
952327568 3:32335002-32335024 CTGCTGGCACATTTGGGGGCTGG + Intronic
952515881 3:34104411-34104433 CTGTTGACACATTAGGGGAAGGG + Intergenic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
956858406 3:73298521-73298543 CTGCTGGCAGATTTATGGTTTGG - Intergenic
957549081 3:81680687-81680709 ATATTACCACATTTGGGGTTAGG - Intronic
958168114 3:89903558-89903580 ATGTTGGCACACTTGAGCTTTGG + Intergenic
965327881 3:167330487-167330509 ATGTAGTCACATTGGGGGTTAGG - Intronic
966525952 3:180919509-180919531 CAGGTGGAACATTTGAGGTTAGG - Intronic
968062094 3:195733362-195733384 CTGTTGCCACATCTGGGGTCAGG - Exonic
969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG + Intronic
972347995 4:38209848-38209870 CTGTTGCAACAATTGGGATTAGG + Intergenic
973766370 4:54166902-54166924 CTGTTATCACATTGGGTGTTAGG + Intronic
974455309 4:62123154-62123176 CTGTTGGGGGTTTTGGGGTTAGG - Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
977598972 4:98915498-98915520 CTGTTGGCCCATGAGGGGATGGG - Intronic
978246472 4:106577976-106577998 CTGTTGCCACATTTTTGTTTGGG + Intergenic
979625262 4:122837623-122837645 GTGTTGGCTCATTTGGAGATGGG + Intronic
982720625 4:158855786-158855808 CTTTTGGCAGATATGTGGTTGGG + Intronic
982947853 4:161648646-161648668 CTGTTTACACAATTTGGGTTTGG + Intronic
984794016 4:183641983-183642005 GGGTTGGCAAATTTGGGGTAAGG + Intronic
985935251 5:3092562-3092584 CTGTTTGCAATTTTTGGGTTTGG - Intergenic
987345493 5:16975312-16975334 ATGTCATCACATTTGGGGTTAGG - Intergenic
989439779 5:41456809-41456831 GTGCTGGCAGATTTGGTGTTTGG - Intronic
990265055 5:54066228-54066250 CTGTTGGCAAATGGGGGCTTAGG - Intronic
993885246 5:93408480-93408502 CTGCTTGCACATTTGGGGTGTGG - Intergenic
994003620 5:94811421-94811443 CTGTTTGAACAGTTGGAGTTCGG - Intronic
995128792 5:108608129-108608151 ATGTTGTCACATTTTGGGTTAGG - Intergenic
995256958 5:110057954-110057976 ATCTTAGCACATTTGGGGCTTGG - Intergenic
996494478 5:124138234-124138256 GTGCTGGCAAATTTGGGTTTTGG + Intergenic
996785979 5:127237151-127237173 ATGTTTGCACATCTGGGTTTTGG + Intergenic
997076736 5:130687588-130687610 CTGTTGGCATGTTTGGGTTCTGG - Intergenic
999865032 5:155691722-155691744 CTGCTGGCAGATTTGGTGTCTGG - Intergenic
1000663800 5:163969759-163969781 CTATAGTCACATTGGGGGTTAGG + Intergenic
1002384527 5:178856331-178856353 CTGTTGGCATAGTAGGGGTGTGG + Intergenic
1003356067 6:5371633-5371655 CTCTTGTCATATTTGGGGATAGG + Intronic
1004299697 6:14446064-14446086 ATGTTGGCACTATTGGGGCTAGG - Intergenic
1005733147 6:28718380-28718402 CTGTTGGCAGTTTTGAGCTTGGG + Intergenic
1007068294 6:39015103-39015125 ATGTTGGCAGACTTGGAGTTGGG + Intronic
1007411653 6:41666295-41666317 CTGGTGGATCATTTGGGGTCAGG - Intergenic
1009816599 6:68744731-68744753 CTGTTGGGGGATATGGGGTTAGG + Intronic
1011284771 6:85711344-85711366 ATATTGCCACATTGGGGGTTAGG - Intergenic
1012746009 6:103090357-103090379 TTATTGGCTCATTTGGGTTTTGG + Intergenic
1016915525 6:149240896-149240918 ATATTGTCACATTTGGGGTTAGG - Intronic
1017760186 6:157562496-157562518 CTCTAGGCAGATTTGGGGTGGGG + Intronic
1018010382 6:159664793-159664815 CTTTTTGCACATTTGGGCCTTGG - Intergenic
1018631887 6:165828779-165828801 CTGATGGGACATTTAGGGTGGGG - Intronic
1018641609 6:165908995-165909017 CAGTGGACACATTTTGGGTTTGG + Intronic
1019158964 6:170057042-170057064 CTGTTGGCGCATTTTTGGTGGGG + Intergenic
1020422850 7:8028911-8028933 TTATTGGCCCATTTGGGCTTTGG - Intronic
1020952108 7:14692962-14692984 ATGTTGGCACATATGGGTTTAGG - Intronic
1023797672 7:43807360-43807382 ATGTTGGGATATTTGGGGTTAGG + Intergenic
1024378888 7:48671329-48671351 ATATAGGCACATTGGGGGTTAGG + Intergenic
1025232714 7:57213306-57213328 CTGCTGGCTCCTGTGGGGTTGGG + Intergenic
1028124258 7:87093794-87093816 CTGTTGGCTTTATTGGGGTTGGG + Intergenic
1028487724 7:91378334-91378356 CTGTTGGCATCTCTGGAGTTGGG - Intergenic
1029020198 7:97357157-97357179 CTGTTGGGAGATTCAGGGTTGGG - Intergenic
1033792379 7:144806200-144806222 GTGTTGGCAAATTTGATGTTTGG - Intronic
1036002324 8:4621369-4621391 ATTTTGGAACATTTGGGATTTGG + Intronic
1038958570 8:32493805-32493827 CTGTTGGAGGATTTGAGGTTTGG + Intronic
1041344309 8:56880209-56880231 CTTTTGGCACCTCTGGTGTTAGG - Intergenic
1042022803 8:64387843-64387865 CTGTGGGCATATTTTGGGATAGG - Intergenic
1042485915 8:69345568-69345590 CTGTTGGCACGTTTGTAGTGAGG + Intergenic
1042688541 8:71469639-71469661 CTTTTAGCACATTTGGACTTAGG + Intronic
1044897541 8:96908561-96908583 CTGAAGGCACATTTGAGGGTTGG + Intronic
1047718869 8:127620241-127620263 CAGTGACCACATTTGGGGTTTGG + Intergenic
1048829128 8:138459050-138459072 CTGTGGGCTGATTTGGGGGTGGG - Intronic
1050060594 9:1705528-1705550 CTGTTTTCACATTTTGGTTTAGG - Intergenic
1050071338 9:1817780-1817802 GAACTGGCACATTTGGGGTTAGG - Intergenic
1050665153 9:7927516-7927538 CTGCTGGCAGATTTGGTGTCTGG + Intergenic
1055110750 9:72556917-72556939 TGGTTGTCACATCTGGGGTTGGG + Intronic
1057511651 9:95684847-95684869 CTGCTGGCAAATCTGGGGCTGGG - Intergenic
1058745162 9:107983278-107983300 CTGTTTACCCATGTGGGGTTGGG - Intergenic
1058810799 9:108637051-108637073 ATGTTGGCACATTTTGGACTTGG - Intergenic
1059445412 9:114334895-114334917 CTGTGGGCACAGCTGTGGTTTGG - Exonic
1060495459 9:124115180-124115202 CTGTTTGCAGCCTTGGGGTTGGG - Intergenic
1187251665 X:17604432-17604454 CTGTTACCACATTTGGGATTGGG + Intronic
1188691663 X:33136714-33136736 ATGTTGGCAGATTTGGTGTCTGG - Intronic
1189578836 X:42384256-42384278 CTGGTGGAACATTTGGGGCCAGG + Intergenic
1189729479 X:44004148-44004170 CTGTTGGGACATTTGGGACATGG - Intergenic
1189880664 X:45488008-45488030 GTGCTGGCAGATTTGGTGTTAGG - Intergenic
1190067076 X:47248811-47248833 ATGTGGGCAAATTTGTGGTTTGG + Intergenic
1190708602 X:53049674-53049696 CTCATGGGACATTTGGGATTGGG - Intronic
1192918422 X:75679670-75679692 ATATTGTCACATTAGGGGTTAGG + Intergenic
1193085692 X:77446741-77446763 CAGTTGCAAAATTTGGGGTTGGG - Intergenic
1194021539 X:88697256-88697278 CTGTTGGCAGGTTGGGGGCTAGG + Intergenic
1195728657 X:107942944-107942966 CAGTTGTCACATTTGAGGTAAGG - Intergenic
1196025092 X:111033668-111033690 CAGTTGGCTAATTTGGTGTTGGG - Intronic
1199683760 X:150245749-150245771 ATGTATGTACATTTGGGGTTGGG + Intergenic
1199827348 X:151513734-151513756 CTGTTGTTAGATTGGGGGTTGGG + Intergenic