ID: 941554469

View in Genome Browser
Species Human (GRCh38)
Location 2:166959302-166959324
Sequence AGGGCTACAGAGACCTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941554462_941554469 14 Left 941554462 2:166959265-166959287 CCTGAAAAGCTGCCCCTGGAGAA No data
Right 941554469 2:166959302-166959324 AGGGCTACAGAGACCTTCCATGG No data
941554463_941554469 2 Left 941554463 2:166959277-166959299 CCCCTGGAGAAAGCCAGATAAAA No data
Right 941554469 2:166959302-166959324 AGGGCTACAGAGACCTTCCATGG No data
941554464_941554469 1 Left 941554464 2:166959278-166959300 CCCTGGAGAAAGCCAGATAAAAT No data
Right 941554469 2:166959302-166959324 AGGGCTACAGAGACCTTCCATGG No data
941554465_941554469 0 Left 941554465 2:166959279-166959301 CCTGGAGAAAGCCAGATAAAATA No data
Right 941554469 2:166959302-166959324 AGGGCTACAGAGACCTTCCATGG No data
941554461_941554469 15 Left 941554461 2:166959264-166959286 CCCTGAAAAGCTGCCCCTGGAGA No data
Right 941554469 2:166959302-166959324 AGGGCTACAGAGACCTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941554469 Original CRISPR AGGGCTACAGAGACCTTCCA TGG Intronic
No off target data available for this crispr