ID: 941561855

View in Genome Browser
Species Human (GRCh38)
Location 2:167056801-167056823
Sequence ATATGGATATGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941561855_941561867 20 Left 941561855 2:167056801-167056823 CCTCCTTCCCTCCATATCCATAT No data
Right 941561867 2:167056844-167056866 TCTTATAAAGCGGGGAGCTTTGG No data
941561855_941561864 10 Left 941561855 2:167056801-167056823 CCTCCTTCCCTCCATATCCATAT No data
Right 941561864 2:167056834-167056856 TATTATATTCTCTTATAAAGCGG No data
941561855_941561866 12 Left 941561855 2:167056801-167056823 CCTCCTTCCCTCCATATCCATAT No data
Right 941561866 2:167056836-167056858 TTATATTCTCTTATAAAGCGGGG No data
941561855_941561865 11 Left 941561855 2:167056801-167056823 CCTCCTTCCCTCCATATCCATAT No data
Right 941561865 2:167056835-167056857 ATTATATTCTCTTATAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941561855 Original CRISPR ATATGGATATGGAGGGAAGG AGG (reversed) Intronic
No off target data available for this crispr