ID: 941567322

View in Genome Browser
Species Human (GRCh38)
Location 2:167125701-167125723
Sequence AAGCTGAACAATAGGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941567319_941567322 19 Left 941567319 2:167125659-167125681 CCTCATTTTTCGTATTTCTGAGT No data
Right 941567322 2:167125701-167125723 AAGCTGAACAATAGGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941567322 Original CRISPR AAGCTGAACAATAGGAAATA TGG Intronic
No off target data available for this crispr