ID: 941570359

View in Genome Browser
Species Human (GRCh38)
Location 2:167162117-167162139
Sequence CCGAATGCTGATAATGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941570359_941570362 4 Left 941570359 2:167162117-167162139 CCTGTATCATTATCAGCATTCGG No data
Right 941570362 2:167162144-167162166 AGCCATTCAACAAGTCTCTAGGG 0: 234
1: 252
2: 195
3: 100
4: 232
941570359_941570361 3 Left 941570359 2:167162117-167162139 CCTGTATCATTATCAGCATTCGG No data
Right 941570361 2:167162143-167162165 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941570359 Original CRISPR CCGAATGCTGATAATGATAC AGG (reversed) Intronic
No off target data available for this crispr