ID: 941571377

View in Genome Browser
Species Human (GRCh38)
Location 2:167175046-167175068
Sequence ATGTATACACTGTTGATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12479
Summary {0: 3, 1: 116, 2: 7238, 3: 3367, 4: 1755}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941571372_941571377 22 Left 941571372 2:167175001-167175023 CCATTATGTGGTCAATTTTAGAA No data
Right 941571377 2:167175046-167175068 ATGTATACACTGTTGATTTGGGG 0: 3
1: 116
2: 7238
3: 3367
4: 1755
941571371_941571377 23 Left 941571371 2:167175000-167175022 CCCATTATGTGGTCAATTTTAGA 0: 1322
1: 1687
2: 6749
3: 2899
4: 1370
Right 941571377 2:167175046-167175068 ATGTATACACTGTTGATTTGGGG 0: 3
1: 116
2: 7238
3: 3367
4: 1755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941571377 Original CRISPR ATGTATACACTGTTGATTTG GGG Intronic
Too many off-targets to display for this crispr