ID: 941575047

View in Genome Browser
Species Human (GRCh38)
Location 2:167219599-167219621
Sequence TGCACAGGGTCCTGTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941575042_941575047 7 Left 941575042 2:167219569-167219591 CCACCTTCATGGATGTGTGACCT No data
Right 941575047 2:167219599-167219621 TGCACAGGGTCCTGTACTCCAGG No data
941575040_941575047 14 Left 941575040 2:167219562-167219584 CCCAGGGCCACCTTCATGGATGT No data
Right 941575047 2:167219599-167219621 TGCACAGGGTCCTGTACTCCAGG No data
941575043_941575047 4 Left 941575043 2:167219572-167219594 CCTTCATGGATGTGTGACCTGTG No data
Right 941575047 2:167219599-167219621 TGCACAGGGTCCTGTACTCCAGG No data
941575041_941575047 13 Left 941575041 2:167219563-167219585 CCAGGGCCACCTTCATGGATGTG No data
Right 941575047 2:167219599-167219621 TGCACAGGGTCCTGTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941575047 Original CRISPR TGCACAGGGTCCTGTACTCC AGG Intronic
No off target data available for this crispr