ID: 941576071

View in Genome Browser
Species Human (GRCh38)
Location 2:167231899-167231921
Sequence CTTACTCTGGTTGCTGCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941576071_941576074 19 Left 941576071 2:167231899-167231921 CCGGTGGCAGCAACCAGAGTAAG No data
Right 941576074 2:167231941-167231963 ACTATATTCTGTACTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941576071 Original CRISPR CTTACTCTGGTTGCTGCCAC CGG (reversed) Intronic