ID: 941576072

View in Genome Browser
Species Human (GRCh38)
Location 2:167231912-167231934
Sequence GACATCTGGTAAACTTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941576072_941576074 6 Left 941576072 2:167231912-167231934 CCAGAGTAAGTTTACCAGATGTC No data
Right 941576074 2:167231941-167231963 ACTATATTCTGTACTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941576072 Original CRISPR GACATCTGGTAAACTTACTC TGG (reversed) Intronic