ID: 941576072 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:167231912-167231934 |
| Sequence | GACATCTGGTAAACTTACTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941576072_941576074 | 6 | Left | 941576072 | 2:167231912-167231934 | CCAGAGTAAGTTTACCAGATGTC | No data | ||
| Right | 941576074 | 2:167231941-167231963 | ACTATATTCTGTACTGTTACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941576072 | Original CRISPR | GACATCTGGTAAACTTACTC TGG (reversed) | Intronic | ||