ID: 941576073

View in Genome Browser
Species Human (GRCh38)
Location 2:167231926-167231948
Sequence AATATAGTTGCAGAGACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941576073_941576077 29 Left 941576073 2:167231926-167231948 CCAGATGTCTCTGCAACTATATT No data
Right 941576077 2:167231978-167232000 AGTCTTATTCTCCAGTTTCCTGG No data
941576073_941576074 -8 Left 941576073 2:167231926-167231948 CCAGATGTCTCTGCAACTATATT No data
Right 941576074 2:167231941-167231963 ACTATATTCTGTACTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941576073 Original CRISPR AATATAGTTGCAGAGACATC TGG (reversed) Intronic