ID: 941576074

View in Genome Browser
Species Human (GRCh38)
Location 2:167231941-167231963
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941576073_941576074 -8 Left 941576073 2:167231926-167231948 CCAGATGTCTCTGCAACTATATT No data
Right 941576074 2:167231941-167231963 ACTATATTCTGTACTGTTACTGG No data
941576071_941576074 19 Left 941576071 2:167231899-167231921 CCGGTGGCAGCAACCAGAGTAAG No data
Right 941576074 2:167231941-167231963 ACTATATTCTGTACTGTTACTGG No data
941576072_941576074 6 Left 941576072 2:167231912-167231934 CCAGAGTAAGTTTACCAGATGTC No data
Right 941576074 2:167231941-167231963 ACTATATTCTGTACTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr