ID: 941578398

View in Genome Browser
Species Human (GRCh38)
Location 2:167265053-167265075
Sequence GTAGTTCTGCTGGTCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941578395_941578398 -10 Left 941578395 2:167265040-167265062 CCAAATCAACTGGGTAGTTCTGC No data
Right 941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG No data
941578392_941578398 -7 Left 941578392 2:167265037-167265059 CCCCCAAATCAACTGGGTAGTTC No data
Right 941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG No data
941578387_941578398 29 Left 941578387 2:167265001-167265023 CCTACACTTTTACTTAAAGATGC No data
Right 941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG No data
941578393_941578398 -8 Left 941578393 2:167265038-167265060 CCCCAAATCAACTGGGTAGTTCT No data
Right 941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG No data
941578391_941578398 -6 Left 941578391 2:167265036-167265058 CCCCCCAAATCAACTGGGTAGTT No data
Right 941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG No data
941578394_941578398 -9 Left 941578394 2:167265039-167265061 CCCAAATCAACTGGGTAGTTCTG No data
Right 941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG No data
941578390_941578398 -5 Left 941578390 2:167265035-167265057 CCCCCCCAAATCAACTGGGTAGT No data
Right 941578398 2:167265053-167265075 GTAGTTCTGCTGGTCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941578398 Original CRISPR GTAGTTCTGCTGGTCTTTGT GGG Intergenic
No off target data available for this crispr