ID: 941578647

View in Genome Browser
Species Human (GRCh38)
Location 2:167267894-167267916
Sequence CAAAATGCTGATAATGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941578644_941578647 4 Left 941578644 2:167267867-167267889 CCTAGAGACTTATCGAATGACTT No data
Right 941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941578647 Original CRISPR CAAAATGCTGATAATGATAT GGG Intergenic