ID: 941578974

View in Genome Browser
Species Human (GRCh38)
Location 2:167271329-167271351
Sequence TGTGTTCCAAGCTCACAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941578973_941578974 8 Left 941578973 2:167271298-167271320 CCATAAATGAGTAGTATGTATTC No data
Right 941578974 2:167271329-167271351 TGTGTTCCAAGCTCACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941578974 Original CRISPR TGTGTTCCAAGCTCACAGCA AGG Intergenic
No off target data available for this crispr