ID: 941580725

View in Genome Browser
Species Human (GRCh38)
Location 2:167293209-167293231
Sequence GAGAAGTGATGCTGGCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941580712_941580725 26 Left 941580712 2:167293160-167293182 CCGGGGAGGGGCGGCCGAGAGAG 0: 1
1: 0
2: 0
3: 18
4: 317
Right 941580725 2:167293209-167293231 GAGAAGTGATGCTGGCGCCGGGG 0: 1
1: 0
2: 2
3: 9
4: 111
941580711_941580725 29 Left 941580711 2:167293157-167293179 CCGCCGGGGAGGGGCGGCCGAGA 0: 1
1: 0
2: 0
3: 25
4: 173
Right 941580725 2:167293209-167293231 GAGAAGTGATGCTGGCGCCGGGG 0: 1
1: 0
2: 2
3: 9
4: 111
941580715_941580725 12 Left 941580715 2:167293174-167293196 CCGAGAGAGCGGAGCACGAGGAG 0: 1
1: 0
2: 0
3: 7
4: 134
Right 941580725 2:167293209-167293231 GAGAAGTGATGCTGGCGCCGGGG 0: 1
1: 0
2: 2
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941580725 Original CRISPR GAGAAGTGATGCTGGCGCCG GGG Intergenic
900116397 1:1029484-1029506 GAGAATTGAGGCTGGGGCTGGGG + Intronic
901027188 1:6284916-6284938 GAGAAGGGATGCTTGAGCCGAGG - Intronic
902992671 1:20200135-20200157 GAGAAGTGGTGCTGGGGTCGGGG - Intergenic
906565464 1:46798017-46798039 GAGAAGTGATGCTGGAACAGTGG - Intronic
907904018 1:58767787-58767809 GAGAAGTTATACTGGCTCCTAGG - Intergenic
910505785 1:87948934-87948956 GGGAAGTGATGCTTGGGCAGTGG + Intergenic
918257863 1:182766245-182766267 GAGAAAAGATGCTGGTGCTGGGG - Intergenic
920750528 1:208670490-208670512 GAGAAGAGAGGGTGGCGCAGAGG + Intergenic
923102582 1:230828011-230828033 GAGAAATGACGCTGGCCCAGGGG + Intergenic
923568227 1:235092544-235092566 GAGAAGTGAGGCGGGGGCGGTGG - Intergenic
1063512088 10:6655495-6655517 AGGAAGAGATGCTGGTGCCGTGG + Intergenic
1082693890 11:56336714-56336736 GAGAAGTAATGCAGGCTCTGAGG + Intergenic
1086124560 11:83336995-83337017 CAGAAGTGATGCTGAGGCAGAGG + Intergenic
1086232545 11:84588057-84588079 GAGGAATGATGCTGGGGCCATGG - Intronic
1089270562 11:117299092-117299114 GAGAAGTGATGCTAGAGGCCGGG - Intronic
1089858454 11:121567770-121567792 GAAACGTGATGCTGGAGGCGGGG - Intronic
1092230567 12:6773506-6773528 GAGAAGGGATGCTGGCGTGAGGG - Intronic
1096081681 12:48837494-48837516 GAGAAGTGAAGATGGAGCCAAGG + Intronic
1096461611 12:51824548-51824570 GAGAGGTGATGCTGGCCACTGGG + Intergenic
1099096014 12:78375668-78375690 GAGAAGTGATGCTGGCAACGTGG - Intergenic
1099373476 12:81866489-81866511 GAGAGGTGATGCTGGTGTCAAGG - Intergenic
1099748395 12:86737201-86737223 GAGCAGTTATGCTGGAGCTGTGG - Intronic
1100331970 12:93591563-93591585 GGGAAGTGATCCTGGCGCCACGG + Intergenic
1101758593 12:107640948-107640970 GAGCAGTGAGGCTGGGGCGGAGG + Intronic
1101900974 12:108790909-108790931 GGGAAGTGATGCAGGAGCAGAGG - Intronic
1103103624 12:118203416-118203438 GAGAAGTAAGCCTGGCGCGGTGG + Intronic
1103552384 12:121747184-121747206 GAGGAGTGATGCTGCCTCCCAGG - Intronic
1107094247 13:36517585-36517607 GAGTAGTGATGCTGGCAACCTGG + Intergenic
1114767455 14:25390173-25390195 GGGAAGTGATGCTGGAGCTGAGG + Intergenic
1118709438 14:68507719-68507741 GAGGAGTGATGCTGGCACTTTGG - Intronic
1121331854 14:93054658-93054680 CAGGAGTGATGCAGGCTCCGAGG - Intronic
1123023068 14:105411315-105411337 GCGAAGGGGAGCTGGCGCCGAGG + Intronic
1126343468 15:47668807-47668829 GAGCAGTGATGATGGCCCAGAGG - Intronic
1130139931 15:81216442-81216464 TAGAAGTGATGCTGAAGCTGAGG - Intronic
1130330915 15:82921652-82921674 GAGAAGTGGTGCTGAAGCTGGGG - Intronic
1130828853 15:87578968-87578990 GAGAAGTGATAGTGGGGGCGGGG + Intergenic
1130884901 15:88084616-88084638 GAGACGTGAGGCTGGAGCAGTGG - Intronic
1135071927 16:19359733-19359755 CAGATGTGATGCTGGAGCTGTGG + Intergenic
1135543043 16:23346757-23346779 GAGAAGTGATGGAGGAGCTGAGG - Intronic
1135618477 16:23932672-23932694 GACAAGTGAAGCTGGCTCAGAGG + Intronic
1136374819 16:29859175-29859197 AAGAAGTGACGCTGGAGCCCCGG - Exonic
1136451220 16:30355242-30355264 AAGAAGAGATGCTTGCGCCAGGG + Exonic
1137013146 16:35344409-35344431 GAGCAGTGTGGATGGCGCCGTGG - Intergenic
1138444493 16:57054955-57054977 GAGGAGGGGTGCTGGCCCCGTGG + Intronic
1139234059 16:65316102-65316124 GAGAACTGAGGCTGGAGCAGTGG - Intergenic
1140539743 16:75745771-75745793 GAGAAGTGATGGTGGTGTGGGGG + Intronic
1141453389 16:84120736-84120758 GAGTAGTGATGCTGGCACTATGG - Intergenic
1149710891 17:58741057-58741079 GAGTAGTGATGCTGGCGATTAGG - Intergenic
1149758782 17:59210327-59210349 CAGAACTGAGGCTGGCGCCGTGG + Exonic
1151075616 17:71268890-71268912 GAGAAATGATGCTTGCCCCCTGG - Intergenic
1152123481 17:78432917-78432939 GAGAAACGGTGCTGGCACCGGGG - Intronic
1152448969 17:80364332-80364354 GAGAAGAGATGCGGGACCCGGGG - Intronic
1152735754 17:81996070-81996092 GGGCAGTGCTGCTGGGGCCGAGG + Intronic
1159065915 18:63567850-63567872 GAGAAGTGCTGCTGGCATTGTGG + Intergenic
1161739590 19:6012572-6012594 GGGGGGTGATGCTGGCTCCGCGG + Intronic
1162413347 19:10519149-10519171 GAGAAGTGAGATTGGCGCCTGGG - Intergenic
1162554152 19:11375934-11375956 GAGAAATGATGATCGCTCCGTGG + Exonic
1163302067 19:16454087-16454109 GAGAAGTGATGCAGGAGTGGGGG + Intronic
1164934988 19:32203097-32203119 GAGAAGGGAGGCTGGTCCCGGGG + Intergenic
1165403567 19:35617094-35617116 GAGAAGTGCAGCTGGGGCTGGGG - Intronic
1167716297 19:51144602-51144624 GACAGGTGAGGCTGGTGCCGTGG - Exonic
1167762318 19:51457521-51457543 GACAGGTGAGGCTGGTGCCGTGG + Exonic
1167770044 19:51509235-51509257 GACAGGTGAGGCTGGCGTCGTGG - Intergenic
925947649 2:8880517-8880539 GATAAATGAGGCTGGAGCCGAGG + Intronic
927809060 2:26172138-26172160 GAGAAGGGATGGTGGCGGTGGGG + Intergenic
930004904 2:46888883-46888905 GAGAGGTGATGGTGGTGCTGTGG - Intergenic
932197436 2:69796678-69796700 TAGAAGTGAAGCTGGGGCAGTGG + Intronic
933143091 2:78817659-78817681 GAGTAGTGATGCTGTCACTGTGG - Intergenic
938247489 2:129790202-129790224 GAGAAGTGAAGTTGGAGCTGAGG + Intergenic
940851505 2:158691613-158691635 GAGAGGTGATTCTGGAGCCCAGG - Intergenic
941580725 2:167293209-167293231 GAGAAGTGATGCTGGCGCCGGGG + Intergenic
947824799 2:233098409-233098431 GAGACGTGGTGCTGGAGGCGTGG + Intronic
948585599 2:239016903-239016925 GCTAAGTGATGCTGGAGCAGTGG - Intergenic
1170767103 20:19299622-19299644 TAGAAGTGTTGCTGGGGCCTGGG + Intronic
1170826384 20:19799724-19799746 GAGAAGAGATGCTGGCGTGAAGG + Intergenic
1172411809 20:34729926-34729948 GAGAGGTGAGGCTGGAGCTGGGG + Intronic
1176172297 20:63701479-63701501 AAGAAGTGATGCTGGGGCCCTGG - Intronic
1177011001 21:15730167-15730189 GAGACGTGAGGCGGCCGCCGTGG + Exonic
1178802768 21:35811448-35811470 GAGAGGTGATGCAGGGGCAGGGG + Intronic
1179181919 21:39053066-39053088 GAGAAGCATTTCTGGCGCCGTGG - Intergenic
1180868637 22:19133865-19133887 GAGACGTGATGCAGGCCCCAGGG + Exonic
1183599534 22:38831962-38831984 GAGAGGAGATGCTGGCTCCAGGG - Intronic
1184327155 22:43797560-43797582 GAGAAGTGATGCTTGTACAGTGG - Intronic
956266362 3:67400690-67400712 GAGAAGGGGTGCTGGCACAGCGG + Intronic
956782380 3:72614216-72614238 GAGATGTGATACTGGAGCTGTGG + Intergenic
958148401 3:89657650-89657672 GAGAAGTGATGATGGAGACCTGG + Intergenic
960592015 3:119375942-119375964 CAGAAGGGTTGCTGGAGCCGTGG - Intronic
961787220 3:129354406-129354428 GAAAAGTGGTGCAGCCGCCGTGG + Intergenic
962274161 3:133999648-133999670 GAAAAGTGAGGCTGGAGCTGAGG + Intronic
966176426 3:177143485-177143507 GTGAAGTGATGATGGGGCAGGGG + Intronic
968200415 3:196749331-196749353 GTGAAGTGATACAGGCGCTGTGG - Intronic
968345645 3:198003043-198003065 GAGAAGTTAGACTGGGGCCGAGG + Exonic
969719856 4:8887682-8887704 CCGAAGTGATGCTGCCGTCGGGG - Intergenic
970178935 4:13367479-13367501 GAGAAGTGATGATGGTACAGTGG + Intronic
970376572 4:15463768-15463790 CAGAAGTGATGCTGGCTTCCTGG - Intergenic
971013510 4:22464551-22464573 GATAAGGGATGCTGGGGCCATGG - Intronic
971236670 4:24848622-24848644 GAGCAGTGATGCTGGCAACTTGG + Intronic
976311668 4:83619438-83619460 GGGAAGTGATGCTGGGGAAGTGG - Intergenic
977492622 4:97733779-97733801 GAGAAGTGATGCTGACCCTGAGG - Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
980415092 4:132477167-132477189 GAGAGGTGATGATGGAGCCTTGG - Intergenic
981718897 4:147779226-147779248 GAGGAGTCATGCTGGAGCAGAGG + Intronic
985769011 5:1797453-1797475 GAGAAGTGATGTGGGTGCTGGGG + Intergenic
987582843 5:19819446-19819468 GAGAAGTGATGAAGACACCGAGG + Intronic
1004037816 6:11941156-11941178 CAGAAGTGAGGCTGGCGGCATGG - Intergenic
1012221662 6:96657155-96657177 GAGAAGTGATGCAGGAACCAAGG + Intergenic
1012452024 6:99362738-99362760 GAGAGGTGATGCTTGGGCTGAGG + Intergenic
1017717212 6:157221416-157221438 GAGAACGGCTGCCGGCGCCGCGG - Intergenic
1018922105 6:168182489-168182511 GGGCAGTGAAGCTGGCGCAGGGG + Intergenic
1027837487 7:83263863-83263885 GAGAAGTAAAGCTGGGACCGAGG - Intergenic
1029546323 7:101212316-101212338 GAGAAGTGGTCCTGGAGCTGCGG + Exonic
1030147270 7:106369397-106369419 GAGAAGTGATGCGGGATCTGTGG + Intergenic
1031011219 7:116526417-116526439 GAGAAGTCAGCCTGGCGGCGGGG - Intronic
1032317687 7:130855186-130855208 GAGAAATGATTCTGGGGCCAGGG + Intergenic
1033415791 7:141160336-141160358 GAGAAGTGAAGCTGGTGCCGGGG - Intronic
1034467607 7:151239019-151239041 GAGGAGTGATGCTGGAGCCCGGG + Exonic
1036444337 8:8808468-8808490 GAGTAGTGATGCTGGCGATTTGG + Intronic
1045474084 8:102538372-102538394 GTGAAGTGATGCTGGTGGCAAGG - Intronic
1056135095 9:83623253-83623275 GACAAGTGTTGCGGGCGCGGCGG + Intronic
1057304832 9:93905968-93905990 CAGAAGGGACGCTGGCGTCGGGG - Intergenic
1057480548 9:95441945-95441967 CAGCAGTGATGCTGGTGACGAGG - Intergenic
1060629455 9:125143140-125143162 GAGGGGTGAGGCTGGCGGCGCGG - Intronic
1198884229 X:141316236-141316258 GACAAGAGATGCTGGCGAGGTGG - Intergenic