ID: 941580953

View in Genome Browser
Species Human (GRCh38)
Location 2:167294218-167294240
Sequence TGCCAGAGGCGCACCAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941580953_941580966 30 Left 941580953 2:167294218-167294240 CCCGGCCTGGTGCGCCTCTGGCA No data
Right 941580966 2:167294271-167294293 GACAAAGTTCAGGCCCGCTGGGG No data
941580953_941580957 -7 Left 941580953 2:167294218-167294240 CCCGGCCTGGTGCGCCTCTGGCA No data
Right 941580957 2:167294234-167294256 TCTGGCAGCTGCCAAATGCCTGG No data
941580953_941580964 28 Left 941580953 2:167294218-167294240 CCCGGCCTGGTGCGCCTCTGGCA No data
Right 941580964 2:167294269-167294291 CCGACAAAGTTCAGGCCCGCTGG No data
941580953_941580961 20 Left 941580953 2:167294218-167294240 CCCGGCCTGGTGCGCCTCTGGCA No data
Right 941580961 2:167294261-167294283 TCCGCTTTCCGACAAAGTTCAGG No data
941580953_941580958 -4 Left 941580953 2:167294218-167294240 CCCGGCCTGGTGCGCCTCTGGCA No data
Right 941580958 2:167294237-167294259 GGCAGCTGCCAAATGCCTGGCGG No data
941580953_941580965 29 Left 941580953 2:167294218-167294240 CCCGGCCTGGTGCGCCTCTGGCA No data
Right 941580965 2:167294270-167294292 CGACAAAGTTCAGGCCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941580953 Original CRISPR TGCCAGAGGCGCACCAGGCC GGG (reversed) Intergenic
No off target data available for this crispr