ID: 941584764

View in Genome Browser
Species Human (GRCh38)
Location 2:167343828-167343850
Sequence CTGTATTAGAAGGGGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941584759_941584764 13 Left 941584759 2:167343792-167343814 CCTCTGTATCTTCAGGTTTTAGT No data
Right 941584764 2:167343828-167343850 CTGTATTAGAAGGGGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941584764 Original CRISPR CTGTATTAGAAGGGGAAAGA TGG Intergenic
No off target data available for this crispr