ID: 941585989

View in Genome Browser
Species Human (GRCh38)
Location 2:167360004-167360026
Sequence AAGCAGATATACATGGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941585989_941585991 9 Left 941585989 2:167360004-167360026 CCATGTACCATGTATATCTGCTT No data
Right 941585991 2:167360036-167360058 TTTTAGATAATAGAAAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941585989 Original CRISPR AAGCAGATATACATGGTACA TGG (reversed) Intergenic
No off target data available for this crispr