ID: 941595167

View in Genome Browser
Species Human (GRCh38)
Location 2:167467303-167467325
Sequence TTGGGTTATTACTTCATGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941595161_941595167 13 Left 941595161 2:167467267-167467289 CCAGAGAAAAAGTGAGAAGAAAA No data
Right 941595167 2:167467303-167467325 TTGGGTTATTACTTCATGTAGGG No data
941595164_941595167 -10 Left 941595164 2:167467290-167467312 CCCAAGTATTCTTTTGGGTTATT No data
Right 941595167 2:167467303-167467325 TTGGGTTATTACTTCATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941595167 Original CRISPR TTGGGTTATTACTTCATGTA GGG Intergenic
No off target data available for this crispr