ID: 941598530

View in Genome Browser
Species Human (GRCh38)
Location 2:167508995-167509017
Sequence CTTGACTCTTTGGGAACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941598530_941598535 13 Left 941598530 2:167508995-167509017 CCTTTTGTTCCCAAAGAGTCAAG No data
Right 941598535 2:167509031-167509053 TTTTGACCTTCACGACAGGAAGG No data
941598530_941598536 17 Left 941598530 2:167508995-167509017 CCTTTTGTTCCCAAAGAGTCAAG No data
Right 941598536 2:167509035-167509057 GACCTTCACGACAGGAAGGATGG No data
941598530_941598534 9 Left 941598530 2:167508995-167509017 CCTTTTGTTCCCAAAGAGTCAAG No data
Right 941598534 2:167509027-167509049 AGGATTTTGACCTTCACGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941598530 Original CRISPR CTTGACTCTTTGGGAACAAA AGG (reversed) Intergenic
No off target data available for this crispr